ID: 1158075091

View in Genome Browser
Species Human (GRCh38)
Location 18:53518629-53518651
Sequence CCTCTTAGTGGGTCCTGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158075087_1158075091 -8 Left 1158075087 18:53518614-53518636 CCATTTTTATTTTTTCCTCTTAG No data
Right 1158075091 18:53518629-53518651 CCTCTTAGTGGGTCCTGCTGAGG No data
1158075083_1158075091 11 Left 1158075083 18:53518595-53518617 CCCATCTCAGAACTCCAGCCCAT No data
Right 1158075091 18:53518629-53518651 CCTCTTAGTGGGTCCTGCTGAGG No data
1158075082_1158075091 29 Left 1158075082 18:53518577-53518599 CCTGAGGCACACTGCTAGCCCAT No data
Right 1158075091 18:53518629-53518651 CCTCTTAGTGGGTCCTGCTGAGG No data
1158075085_1158075091 -3 Left 1158075085 18:53518609-53518631 CCAGCCCATTTTTATTTTTTCCT No data
Right 1158075091 18:53518629-53518651 CCTCTTAGTGGGTCCTGCTGAGG No data
1158075086_1158075091 -7 Left 1158075086 18:53518613-53518635 CCCATTTTTATTTTTTCCTCTTA No data
Right 1158075091 18:53518629-53518651 CCTCTTAGTGGGTCCTGCTGAGG No data
1158075084_1158075091 10 Left 1158075084 18:53518596-53518618 CCATCTCAGAACTCCAGCCCATT No data
Right 1158075091 18:53518629-53518651 CCTCTTAGTGGGTCCTGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158075091 Original CRISPR CCTCTTAGTGGGTCCTGCTG AGG Intronic