ID: 1158077209

View in Genome Browser
Species Human (GRCh38)
Location 18:53544729-53544751
Sequence CTTCACTCATGCAACTTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158077209_1158077215 27 Left 1158077209 18:53544729-53544751 CCAGGAAAGTTGCATGAGTGAAG No data
Right 1158077215 18:53544779-53544801 ACCTTTTCAGGACCCAAAGCAGG No data
1158077209_1158077214 15 Left 1158077209 18:53544729-53544751 CCAGGAAAGTTGCATGAGTGAAG No data
Right 1158077214 18:53544767-53544789 AGCAGAAAATGGACCTTTTCAGG No data
1158077209_1158077217 30 Left 1158077209 18:53544729-53544751 CCAGGAAAGTTGCATGAGTGAAG No data
Right 1158077217 18:53544782-53544804 TTTTCAGGACCCAAAGCAGGAGG No data
1158077209_1158077212 4 Left 1158077209 18:53544729-53544751 CCAGGAAAGTTGCATGAGTGAAG No data
Right 1158077212 18:53544756-53544778 CCCTCACTTACAGCAGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158077209 Original CRISPR CTTCACTCATGCAACTTTCC TGG (reversed) Intergenic