ID: 1158077211

View in Genome Browser
Species Human (GRCh38)
Location 18:53544756-53544778
Sequence CCATTTTCTGCTGTAAGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158077211_1158077217 3 Left 1158077211 18:53544756-53544778 CCCTCACTTACAGCAGAAAATGG No data
Right 1158077217 18:53544782-53544804 TTTTCAGGACCCAAAGCAGGAGG No data
1158077211_1158077220 28 Left 1158077211 18:53544756-53544778 CCCTCACTTACAGCAGAAAATGG No data
Right 1158077220 18:53544807-53544829 ACTCCACACCCTCATCCAAGAGG No data
1158077211_1158077215 0 Left 1158077211 18:53544756-53544778 CCCTCACTTACAGCAGAAAATGG No data
Right 1158077215 18:53544779-53544801 ACCTTTTCAGGACCCAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158077211 Original CRISPR CCATTTTCTGCTGTAAGTGA GGG (reversed) Intergenic