ID: 1158077213

View in Genome Browser
Species Human (GRCh38)
Location 18:53544757-53544779
Sequence TCCATTTTCTGCTGTAAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158077213_1158077220 27 Left 1158077213 18:53544757-53544779 CCTCACTTACAGCAGAAAATGGA No data
Right 1158077220 18:53544807-53544829 ACTCCACACCCTCATCCAAGAGG No data
1158077213_1158077215 -1 Left 1158077213 18:53544757-53544779 CCTCACTTACAGCAGAAAATGGA No data
Right 1158077215 18:53544779-53544801 ACCTTTTCAGGACCCAAAGCAGG No data
1158077213_1158077217 2 Left 1158077213 18:53544757-53544779 CCTCACTTACAGCAGAAAATGGA No data
Right 1158077217 18:53544782-53544804 TTTTCAGGACCCAAAGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158077213 Original CRISPR TCCATTTTCTGCTGTAAGTG AGG (reversed) Intergenic