ID: 1158077215

View in Genome Browser
Species Human (GRCh38)
Location 18:53544779-53544801
Sequence ACCTTTTCAGGACCCAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158077211_1158077215 0 Left 1158077211 18:53544756-53544778 CCCTCACTTACAGCAGAAAATGG No data
Right 1158077215 18:53544779-53544801 ACCTTTTCAGGACCCAAAGCAGG No data
1158077209_1158077215 27 Left 1158077209 18:53544729-53544751 CCAGGAAAGTTGCATGAGTGAAG No data
Right 1158077215 18:53544779-53544801 ACCTTTTCAGGACCCAAAGCAGG No data
1158077213_1158077215 -1 Left 1158077213 18:53544757-53544779 CCTCACTTACAGCAGAAAATGGA No data
Right 1158077215 18:53544779-53544801 ACCTTTTCAGGACCCAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158077215 Original CRISPR ACCTTTTCAGGACCCAAAGC AGG Intergenic