ID: 1158077216

View in Genome Browser
Species Human (GRCh38)
Location 18:53544780-53544802
Sequence TCCTGCTTTGGGTCCTGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158077216_1158077226 24 Left 1158077216 18:53544780-53544802 CCTTTTCAGGACCCAAAGCAGGA No data
Right 1158077226 18:53544827-53544849 AGGATAGAGAAGCAGAGGCCAGG No data
1158077216_1158077225 19 Left 1158077216 18:53544780-53544802 CCTTTTCAGGACCCAAAGCAGGA No data
Right 1158077225 18:53544822-53544844 CCAAGAGGATAGAGAAGCAGAGG No data
1158077216_1158077220 4 Left 1158077216 18:53544780-53544802 CCTTTTCAGGACCCAAAGCAGGA No data
Right 1158077220 18:53544807-53544829 ACTCCACACCCTCATCCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158077216 Original CRISPR TCCTGCTTTGGGTCCTGAAA AGG (reversed) Intergenic