ID: 1158077218

View in Genome Browser
Species Human (GRCh38)
Location 18:53544791-53544813
Sequence GTGGAGTAGCCTCCTGCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158077218_1158077227 23 Left 1158077218 18:53544791-53544813 CCCAAAGCAGGAGGCTACTCCAC No data
Right 1158077227 18:53544837-53544859 AGCAGAGGCCAGGTGTTAACAGG No data
1158077218_1158077226 13 Left 1158077218 18:53544791-53544813 CCCAAAGCAGGAGGCTACTCCAC No data
Right 1158077226 18:53544827-53544849 AGGATAGAGAAGCAGAGGCCAGG No data
1158077218_1158077225 8 Left 1158077218 18:53544791-53544813 CCCAAAGCAGGAGGCTACTCCAC No data
Right 1158077225 18:53544822-53544844 CCAAGAGGATAGAGAAGCAGAGG No data
1158077218_1158077220 -7 Left 1158077218 18:53544791-53544813 CCCAAAGCAGGAGGCTACTCCAC No data
Right 1158077220 18:53544807-53544829 ACTCCACACCCTCATCCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158077218 Original CRISPR GTGGAGTAGCCTCCTGCTTT GGG (reversed) Intergenic
No off target data available for this crispr