ID: 1158077219

View in Genome Browser
Species Human (GRCh38)
Location 18:53544792-53544814
Sequence TGTGGAGTAGCCTCCTGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158077219_1158077220 -8 Left 1158077219 18:53544792-53544814 CCAAAGCAGGAGGCTACTCCACA No data
Right 1158077220 18:53544807-53544829 ACTCCACACCCTCATCCAAGAGG No data
1158077219_1158077225 7 Left 1158077219 18:53544792-53544814 CCAAAGCAGGAGGCTACTCCACA No data
Right 1158077225 18:53544822-53544844 CCAAGAGGATAGAGAAGCAGAGG No data
1158077219_1158077227 22 Left 1158077219 18:53544792-53544814 CCAAAGCAGGAGGCTACTCCACA No data
Right 1158077227 18:53544837-53544859 AGCAGAGGCCAGGTGTTAACAGG No data
1158077219_1158077226 12 Left 1158077219 18:53544792-53544814 CCAAAGCAGGAGGCTACTCCACA No data
Right 1158077226 18:53544827-53544849 AGGATAGAGAAGCAGAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158077219 Original CRISPR TGTGGAGTAGCCTCCTGCTT TGG (reversed) Intergenic