ID: 1158077220

View in Genome Browser
Species Human (GRCh38)
Location 18:53544807-53544829
Sequence ACTCCACACCCTCATCCAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158077211_1158077220 28 Left 1158077211 18:53544756-53544778 CCCTCACTTACAGCAGAAAATGG No data
Right 1158077220 18:53544807-53544829 ACTCCACACCCTCATCCAAGAGG No data
1158077219_1158077220 -8 Left 1158077219 18:53544792-53544814 CCAAAGCAGGAGGCTACTCCACA No data
Right 1158077220 18:53544807-53544829 ACTCCACACCCTCATCCAAGAGG No data
1158077218_1158077220 -7 Left 1158077218 18:53544791-53544813 CCCAAAGCAGGAGGCTACTCCAC No data
Right 1158077220 18:53544807-53544829 ACTCCACACCCTCATCCAAGAGG No data
1158077216_1158077220 4 Left 1158077216 18:53544780-53544802 CCTTTTCAGGACCCAAAGCAGGA No data
Right 1158077220 18:53544807-53544829 ACTCCACACCCTCATCCAAGAGG No data
1158077213_1158077220 27 Left 1158077213 18:53544757-53544779 CCTCACTTACAGCAGAAAATGGA No data
Right 1158077220 18:53544807-53544829 ACTCCACACCCTCATCCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158077220 Original CRISPR ACTCCACACCCTCATCCAAG AGG Intergenic