ID: 1158077226

View in Genome Browser
Species Human (GRCh38)
Location 18:53544827-53544849
Sequence AGGATAGAGAAGCAGAGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158077216_1158077226 24 Left 1158077216 18:53544780-53544802 CCTTTTCAGGACCCAAAGCAGGA No data
Right 1158077226 18:53544827-53544849 AGGATAGAGAAGCAGAGGCCAGG No data
1158077219_1158077226 12 Left 1158077219 18:53544792-53544814 CCAAAGCAGGAGGCTACTCCACA No data
Right 1158077226 18:53544827-53544849 AGGATAGAGAAGCAGAGGCCAGG No data
1158077221_1158077226 -6 Left 1158077221 18:53544810-53544832 CCACACCCTCATCCAAGAGGATA No data
Right 1158077226 18:53544827-53544849 AGGATAGAGAAGCAGAGGCCAGG No data
1158077218_1158077226 13 Left 1158077218 18:53544791-53544813 CCCAAAGCAGGAGGCTACTCCAC No data
Right 1158077226 18:53544827-53544849 AGGATAGAGAAGCAGAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158077226 Original CRISPR AGGATAGAGAAGCAGAGGCC AGG Intergenic