ID: 1158077227

View in Genome Browser
Species Human (GRCh38)
Location 18:53544837-53544859
Sequence AGCAGAGGCCAGGTGTTAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158077221_1158077227 4 Left 1158077221 18:53544810-53544832 CCACACCCTCATCCAAGAGGATA No data
Right 1158077227 18:53544837-53544859 AGCAGAGGCCAGGTGTTAACAGG No data
1158077219_1158077227 22 Left 1158077219 18:53544792-53544814 CCAAAGCAGGAGGCTACTCCACA No data
Right 1158077227 18:53544837-53544859 AGCAGAGGCCAGGTGTTAACAGG No data
1158077222_1158077227 -1 Left 1158077222 18:53544815-53544837 CCCTCATCCAAGAGGATAGAGAA No data
Right 1158077227 18:53544837-53544859 AGCAGAGGCCAGGTGTTAACAGG No data
1158077223_1158077227 -2 Left 1158077223 18:53544816-53544838 CCTCATCCAAGAGGATAGAGAAG No data
Right 1158077227 18:53544837-53544859 AGCAGAGGCCAGGTGTTAACAGG No data
1158077218_1158077227 23 Left 1158077218 18:53544791-53544813 CCCAAAGCAGGAGGCTACTCCAC No data
Right 1158077227 18:53544837-53544859 AGCAGAGGCCAGGTGTTAACAGG No data
1158077224_1158077227 -8 Left 1158077224 18:53544822-53544844 CCAAGAGGATAGAGAAGCAGAGG No data
Right 1158077227 18:53544837-53544859 AGCAGAGGCCAGGTGTTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158077227 Original CRISPR AGCAGAGGCCAGGTGTTAAC AGG Intergenic