ID: 1158078716

View in Genome Browser
Species Human (GRCh38)
Location 18:53563080-53563102
Sequence AGTCTCCCTTTTATGTAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158078716_1158078718 24 Left 1158078716 18:53563080-53563102 CCATCTTACATAAAAGGGAGACT No data
Right 1158078718 18:53563127-53563149 TTGTGGTCCCAGATATATCATGG No data
1158078716_1158078717 7 Left 1158078716 18:53563080-53563102 CCATCTTACATAAAAGGGAGACT No data
Right 1158078717 18:53563110-53563132 AAGAATATTCAAGTGCATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158078716 Original CRISPR AGTCTCCCTTTTATGTAAGA TGG (reversed) Intergenic
No off target data available for this crispr