ID: 1158082940

View in Genome Browser
Species Human (GRCh38)
Location 18:53615728-53615750
Sequence CAGGGTAAGCAGGCTGTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158082940_1158082948 14 Left 1158082940 18:53615728-53615750 CCAACCACAGCCTGCTTACCCTG No data
Right 1158082948 18:53615765-53615787 TCCCACAGAAACCACCACAAAGG No data
1158082940_1158082952 27 Left 1158082940 18:53615728-53615750 CCAACCACAGCCTGCTTACCCTG No data
Right 1158082952 18:53615778-53615800 ACCACAAAGGCTCTTACCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158082940 Original CRISPR CAGGGTAAGCAGGCTGTGGT TGG (reversed) Intergenic
No off target data available for this crispr