ID: 1158086492

View in Genome Browser
Species Human (GRCh38)
Location 18:53657477-53657499
Sequence GAAGCTATTGAGATGGGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158086487_1158086492 9 Left 1158086487 18:53657445-53657467 CCAAGTATGTGGTAATTCATTAC No data
Right 1158086492 18:53657477-53657499 GAAGCTATTGAGATGGGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158086492 Original CRISPR GAAGCTATTGAGATGGGATC TGG Intergenic
No off target data available for this crispr