ID: 1158087807

View in Genome Browser
Species Human (GRCh38)
Location 18:53673805-53673827
Sequence AGCCCAGGCTAAACCCAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158087807_1158087809 -4 Left 1158087807 18:53673805-53673827 CCACTTTGGGTTTAGCCTGGGCT No data
Right 1158087809 18:53673824-53673846 GGCTAGCTGCTGTGTTTCCTAGG No data
1158087807_1158087810 -3 Left 1158087807 18:53673805-53673827 CCACTTTGGGTTTAGCCTGGGCT No data
Right 1158087810 18:53673825-53673847 GCTAGCTGCTGTGTTTCCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158087807 Original CRISPR AGCCCAGGCTAAACCCAAAG TGG (reversed) Intergenic
No off target data available for this crispr