ID: 1158089272

View in Genome Browser
Species Human (GRCh38)
Location 18:53691757-53691779
Sequence GGGGTTGTTATAGAATTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158089272_1158089278 20 Left 1158089272 18:53691757-53691779 CCCTCAAATTCTATAACAACCCC No data
Right 1158089278 18:53691800-53691822 CATAGATCACCGAGCTTTTCAGG No data
1158089272_1158089279 21 Left 1158089272 18:53691757-53691779 CCCTCAAATTCTATAACAACCCC No data
Right 1158089279 18:53691801-53691823 ATAGATCACCGAGCTTTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158089272 Original CRISPR GGGGTTGTTATAGAATTTGA GGG (reversed) Intergenic
No off target data available for this crispr