ID: 1158089440

View in Genome Browser
Species Human (GRCh38)
Location 18:53693728-53693750
Sequence AAATAACCACAGACTGAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158089440_1158089442 28 Left 1158089440 18:53693728-53693750 CCAAGTTCAGTCTGTGGTTATTT No data
Right 1158089442 18:53693779-53693801 TTTGTTGTTGTTGTTGTTGTTGG 0: 86
1: 362
2: 779
3: 1612
4: 3649

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158089440 Original CRISPR AAATAACCACAGACTGAACT TGG (reversed) Intergenic
No off target data available for this crispr