ID: 1158100022

View in Genome Browser
Species Human (GRCh38)
Location 18:53819909-53819931
Sequence GGAGTTGTTGCCAGAGGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158100015_1158100022 11 Left 1158100015 18:53819875-53819897 CCACAGCAAAGCACTTTTGCTGG No data
Right 1158100022 18:53819909-53819931 GGAGTTGTTGCCAGAGGACCAGG No data
1158100013_1158100022 23 Left 1158100013 18:53819863-53819885 CCACTACCACTGCCACAGCAAAG No data
Right 1158100022 18:53819909-53819931 GGAGTTGTTGCCAGAGGACCAGG No data
1158100014_1158100022 17 Left 1158100014 18:53819869-53819891 CCACTGCCACAGCAAAGCACTTT No data
Right 1158100022 18:53819909-53819931 GGAGTTGTTGCCAGAGGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158100022 Original CRISPR GGAGTTGTTGCCAGAGGACC AGG Intergenic
No off target data available for this crispr