ID: 1158102847 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 18:53850009-53850031 |
Sequence | TTGTAAACTGAGATGAAACT AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1158102846_1158102847 | -8 | Left | 1158102846 | 18:53849994-53850016 | CCATGGATCATGGTCTTGTAAAC | No data | ||
Right | 1158102847 | 18:53850009-53850031 | TTGTAAACTGAGATGAAACTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1158102847 | Original CRISPR | TTGTAAACTGAGATGAAACT AGG | Intergenic | ||
No off target data available for this crispr |