ID: 1158102847

View in Genome Browser
Species Human (GRCh38)
Location 18:53850009-53850031
Sequence TTGTAAACTGAGATGAAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158102846_1158102847 -8 Left 1158102846 18:53849994-53850016 CCATGGATCATGGTCTTGTAAAC No data
Right 1158102847 18:53850009-53850031 TTGTAAACTGAGATGAAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158102847 Original CRISPR TTGTAAACTGAGATGAAACT AGG Intergenic
No off target data available for this crispr