ID: 1158102997

View in Genome Browser
Species Human (GRCh38)
Location 18:53851904-53851926
Sequence CTTTCTATGAAGAGGTACCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158102993_1158102997 29 Left 1158102993 18:53851852-53851874 CCTATGGCTTTATTCTTTATTTG No data
Right 1158102997 18:53851904-53851926 CTTTCTATGAAGAGGTACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158102997 Original CRISPR CTTTCTATGAAGAGGTACCT AGG Intergenic
No off target data available for this crispr