ID: 1158106025

View in Genome Browser
Species Human (GRCh38)
Location 18:53885740-53885762
Sequence CAGTATCACTTTGATATACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158106025_1158106026 -7 Left 1158106025 18:53885740-53885762 CCATGTATATCAAAGTGATACTG No data
Right 1158106026 18:53885756-53885778 GATACTGCACTTTTCTTCTCAGG No data
1158106025_1158106027 -6 Left 1158106025 18:53885740-53885762 CCATGTATATCAAAGTGATACTG No data
Right 1158106027 18:53885757-53885779 ATACTGCACTTTTCTTCTCAGGG No data
1158106025_1158106028 -5 Left 1158106025 18:53885740-53885762 CCATGTATATCAAAGTGATACTG No data
Right 1158106028 18:53885758-53885780 TACTGCACTTTTCTTCTCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158106025 Original CRISPR CAGTATCACTTTGATATACA TGG (reversed) Intergenic
No off target data available for this crispr