ID: 1158106891

View in Genome Browser
Species Human (GRCh38)
Location 18:53895542-53895564
Sequence CCTAGACCTGGGAGGGGGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158106891_1158106901 6 Left 1158106891 18:53895542-53895564 CCGGACCCCCTCCCAGGTCTAGG No data
Right 1158106901 18:53895571-53895593 AAATTTTCTAACTAGTCTCTGGG No data
1158106891_1158106900 5 Left 1158106891 18:53895542-53895564 CCGGACCCCCTCCCAGGTCTAGG No data
Right 1158106900 18:53895570-53895592 TAAATTTTCTAACTAGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158106891 Original CRISPR CCTAGACCTGGGAGGGGGTC CGG (reversed) Intergenic
No off target data available for this crispr