ID: 1158110150

View in Genome Browser
Species Human (GRCh38)
Location 18:53931767-53931789
Sequence AAGGACCACCTGATGTTATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158110150_1158110154 10 Left 1158110150 18:53931767-53931789 CCTCATAACATCAGGTGGTCCTT No data
Right 1158110154 18:53931800-53931822 ATCAGAGATAAAAGACGGAGAGG No data
1158110150_1158110153 5 Left 1158110150 18:53931767-53931789 CCTCATAACATCAGGTGGTCCTT No data
Right 1158110153 18:53931795-53931817 ACAGAATCAGAGATAAAAGACGG No data
1158110150_1158110155 21 Left 1158110150 18:53931767-53931789 CCTCATAACATCAGGTGGTCCTT No data
Right 1158110155 18:53931811-53931833 AAGACGGAGAGGTACTCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158110150 Original CRISPR AAGGACCACCTGATGTTATG AGG (reversed) Intergenic
No off target data available for this crispr