ID: 1158115113

View in Genome Browser
Species Human (GRCh38)
Location 18:53986899-53986921
Sequence CTTCTGGGAGGAGGTGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158115113_1158115124 14 Left 1158115113 18:53986899-53986921 CCACCCACACCTCCTCCCAGAAG No data
Right 1158115124 18:53986936-53986958 GATCAAATTCCCCCATTGGATGG No data
1158115113_1158115130 30 Left 1158115113 18:53986899-53986921 CCACCCACACCTCCTCCCAGAAG No data
Right 1158115130 18:53986952-53986974 TGGATGGTCTCTACATGGCCAGG No data
1158115113_1158115123 10 Left 1158115113 18:53986899-53986921 CCACCCACACCTCCTCCCAGAAG No data
Right 1158115123 18:53986932-53986954 GGGTGATCAAATTCCCCCATTGG No data
1158115113_1158115120 -10 Left 1158115113 18:53986899-53986921 CCACCCACACCTCCTCCCAGAAG No data
Right 1158115120 18:53986912-53986934 CTCCCAGAAGAAACAGACAGGGG No data
1158115113_1158115128 25 Left 1158115113 18:53986899-53986921 CCACCCACACCTCCTCCCAGAAG No data
Right 1158115128 18:53986947-53986969 CCCATTGGATGGTCTCTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158115113 Original CRISPR CTTCTGGGAGGAGGTGTGGG TGG (reversed) Intergenic
No off target data available for this crispr