ID: 1158115115

View in Genome Browser
Species Human (GRCh38)
Location 18:53986903-53986925
Sequence GTTTCTTCTGGGAGGAGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158115115_1158115123 6 Left 1158115115 18:53986903-53986925 CCACACCTCCTCCCAGAAGAAAC No data
Right 1158115123 18:53986932-53986954 GGGTGATCAAATTCCCCCATTGG No data
1158115115_1158115124 10 Left 1158115115 18:53986903-53986925 CCACACCTCCTCCCAGAAGAAAC No data
Right 1158115124 18:53986936-53986958 GATCAAATTCCCCCATTGGATGG No data
1158115115_1158115130 26 Left 1158115115 18:53986903-53986925 CCACACCTCCTCCCAGAAGAAAC No data
Right 1158115130 18:53986952-53986974 TGGATGGTCTCTACATGGCCAGG No data
1158115115_1158115128 21 Left 1158115115 18:53986903-53986925 CCACACCTCCTCCCAGAAGAAAC No data
Right 1158115128 18:53986947-53986969 CCCATTGGATGGTCTCTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158115115 Original CRISPR GTTTCTTCTGGGAGGAGGTG TGG (reversed) Intergenic
No off target data available for this crispr