ID: 1158115116

View in Genome Browser
Species Human (GRCh38)
Location 18:53986908-53986930
Sequence TGTCTGTTTCTTCTGGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158115116_1158115130 21 Left 1158115116 18:53986908-53986930 CCTCCTCCCAGAAGAAACAGACA No data
Right 1158115130 18:53986952-53986974 TGGATGGTCTCTACATGGCCAGG No data
1158115116_1158115128 16 Left 1158115116 18:53986908-53986930 CCTCCTCCCAGAAGAAACAGACA No data
Right 1158115128 18:53986947-53986969 CCCATTGGATGGTCTCTACATGG No data
1158115116_1158115123 1 Left 1158115116 18:53986908-53986930 CCTCCTCCCAGAAGAAACAGACA No data
Right 1158115123 18:53986932-53986954 GGGTGATCAAATTCCCCCATTGG No data
1158115116_1158115124 5 Left 1158115116 18:53986908-53986930 CCTCCTCCCAGAAGAAACAGACA No data
Right 1158115124 18:53986936-53986958 GATCAAATTCCCCCATTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158115116 Original CRISPR TGTCTGTTTCTTCTGGGAGG AGG (reversed) Intergenic
No off target data available for this crispr