ID: 1158115120

View in Genome Browser
Species Human (GRCh38)
Location 18:53986912-53986934
Sequence CTCCCAGAAGAAACAGACAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158115111_1158115120 -5 Left 1158115111 18:53986894-53986916 CCTTCCCACCCACACCTCCTCCC No data
Right 1158115120 18:53986912-53986934 CTCCCAGAAGAAACAGACAGGGG No data
1158115112_1158115120 -9 Left 1158115112 18:53986898-53986920 CCCACCCACACCTCCTCCCAGAA No data
Right 1158115120 18:53986912-53986934 CTCCCAGAAGAAACAGACAGGGG No data
1158115113_1158115120 -10 Left 1158115113 18:53986899-53986921 CCACCCACACCTCCTCCCAGAAG No data
Right 1158115120 18:53986912-53986934 CTCCCAGAAGAAACAGACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158115120 Original CRISPR CTCCCAGAAGAAACAGACAG GGG Intergenic
No off target data available for this crispr