ID: 1158115128

View in Genome Browser
Species Human (GRCh38)
Location 18:53986947-53986969
Sequence CCCATTGGATGGTCTCTACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158115111_1158115128 30 Left 1158115111 18:53986894-53986916 CCTTCCCACCCACACCTCCTCCC No data
Right 1158115128 18:53986947-53986969 CCCATTGGATGGTCTCTACATGG No data
1158115122_1158115128 9 Left 1158115122 18:53986915-53986937 CCAGAAGAAACAGACAGGGGTGA No data
Right 1158115128 18:53986947-53986969 CCCATTGGATGGTCTCTACATGG No data
1158115113_1158115128 25 Left 1158115113 18:53986899-53986921 CCACCCACACCTCCTCCCAGAAG No data
Right 1158115128 18:53986947-53986969 CCCATTGGATGGTCTCTACATGG No data
1158115116_1158115128 16 Left 1158115116 18:53986908-53986930 CCTCCTCCCAGAAGAAACAGACA No data
Right 1158115128 18:53986947-53986969 CCCATTGGATGGTCTCTACATGG No data
1158115118_1158115128 13 Left 1158115118 18:53986911-53986933 CCTCCCAGAAGAAACAGACAGGG No data
Right 1158115128 18:53986947-53986969 CCCATTGGATGGTCTCTACATGG No data
1158115114_1158115128 22 Left 1158115114 18:53986902-53986924 CCCACACCTCCTCCCAGAAGAAA No data
Right 1158115128 18:53986947-53986969 CCCATTGGATGGTCTCTACATGG No data
1158115112_1158115128 26 Left 1158115112 18:53986898-53986920 CCCACCCACACCTCCTCCCAGAA No data
Right 1158115128 18:53986947-53986969 CCCATTGGATGGTCTCTACATGG No data
1158115121_1158115128 10 Left 1158115121 18:53986914-53986936 CCCAGAAGAAACAGACAGGGGTG No data
Right 1158115128 18:53986947-53986969 CCCATTGGATGGTCTCTACATGG No data
1158115115_1158115128 21 Left 1158115115 18:53986903-53986925 CCACACCTCCTCCCAGAAGAAAC No data
Right 1158115128 18:53986947-53986969 CCCATTGGATGGTCTCTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158115128 Original CRISPR CCCATTGGATGGTCTCTACA TGG Intergenic
No off target data available for this crispr