ID: 1158115239

View in Genome Browser
Species Human (GRCh38)
Location 18:53987828-53987850
Sequence CAAGATACTGACATTCATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158115239_1158115242 22 Left 1158115239 18:53987828-53987850 CCTATATGAATGTCAGTATCTTG No data
Right 1158115242 18:53987873-53987895 TTTGAAGAAGTTACCATTGGAGG No data
1158115239_1158115241 19 Left 1158115239 18:53987828-53987850 CCTATATGAATGTCAGTATCTTG No data
Right 1158115241 18:53987870-53987892 TTTTTTGAAGAAGTTACCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158115239 Original CRISPR CAAGATACTGACATTCATAT AGG (reversed) Intergenic
No off target data available for this crispr