ID: 1158115241

View in Genome Browser
Species Human (GRCh38)
Location 18:53987870-53987892
Sequence TTTTTTGAAGAAGTTACCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158115239_1158115241 19 Left 1158115239 18:53987828-53987850 CCTATATGAATGTCAGTATCTTG No data
Right 1158115241 18:53987870-53987892 TTTTTTGAAGAAGTTACCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158115241 Original CRISPR TTTTTTGAAGAAGTTACCAT TGG Intergenic
No off target data available for this crispr