ID: 1158115242

View in Genome Browser
Species Human (GRCh38)
Location 18:53987873-53987895
Sequence TTTGAAGAAGTTACCATTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158115239_1158115242 22 Left 1158115239 18:53987828-53987850 CCTATATGAATGTCAGTATCTTG No data
Right 1158115242 18:53987873-53987895 TTTGAAGAAGTTACCATTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158115242 Original CRISPR TTTGAAGAAGTTACCATTGG AGG Intergenic
No off target data available for this crispr