ID: 1158117010

View in Genome Browser
Species Human (GRCh38)
Location 18:54006396-54006418
Sequence TTGTTGTAGTCTTCACAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158117010_1158117013 30 Left 1158117010 18:54006396-54006418 CCAGGCTGTGAAGACTACAACAA No data
Right 1158117013 18:54006449-54006471 ATGCACATCCATAAGCATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158117010 Original CRISPR TTGTTGTAGTCTTCACAGCC TGG (reversed) Intergenic
No off target data available for this crispr