ID: 1158119604

View in Genome Browser
Species Human (GRCh38)
Location 18:54033897-54033919
Sequence AAGCAATCTAGTATCTATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158119604_1158119605 -8 Left 1158119604 18:54033897-54033919 CCAAAATAGATACTAGATTGCTT No data
Right 1158119605 18:54033912-54033934 GATTGCTTTTCCATCTACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158119604 Original CRISPR AAGCAATCTAGTATCTATTT TGG (reversed) Intergenic
No off target data available for this crispr