ID: 1158124479

View in Genome Browser
Species Human (GRCh38)
Location 18:54086285-54086307
Sequence ATCTGAATAAGGAGTTTCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158124479_1158124484 14 Left 1158124479 18:54086285-54086307 CCTTGGAAACTCCTTATTCAGAT No data
Right 1158124484 18:54086322-54086344 TGCTTTTTTTCAGATAGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158124479 Original CRISPR ATCTGAATAAGGAGTTTCCA AGG (reversed) Intergenic
No off target data available for this crispr