ID: 1158124510 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 18:54086654-54086676 |
| Sequence | CCTAATATACTCATGGTGGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1158124505_1158124510 | -2 | Left | 1158124505 | 18:54086633-54086655 | CCACAATTACTTTTGCACCAACC | 0: 1114 1: 1952 2: 1549 3: 983 4: 604 |
||
| Right | 1158124510 | 18:54086654-54086676 | CCTAATATACTCATGGTGGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1158124510 | Original CRISPR | CCTAATATACTCATGGTGGA AGG | Intergenic | ||
| No off target data available for this crispr | |||||