ID: 1158124510

View in Genome Browser
Species Human (GRCh38)
Location 18:54086654-54086676
Sequence CCTAATATACTCATGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158124505_1158124510 -2 Left 1158124505 18:54086633-54086655 CCACAATTACTTTTGCACCAACC 0: 1114
1: 1952
2: 1549
3: 983
4: 604
Right 1158124510 18:54086654-54086676 CCTAATATACTCATGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158124510 Original CRISPR CCTAATATACTCATGGTGGA AGG Intergenic
No off target data available for this crispr