ID: 1158124997

View in Genome Browser
Species Human (GRCh38)
Location 18:54091428-54091450
Sequence CTGCTGTCACTGTTTAATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158124997_1158125000 15 Left 1158124997 18:54091428-54091450 CCTTTATTAAACAGTGACAGCAG No data
Right 1158125000 18:54091466-54091488 TTCTAATGGGATCCTTTCGCTGG No data
1158124997_1158124998 1 Left 1158124997 18:54091428-54091450 CCTTTATTAAACAGTGACAGCAG No data
Right 1158124998 18:54091452-54091474 AACTTTGTTCTGAGTTCTAATGG No data
1158124997_1158124999 2 Left 1158124997 18:54091428-54091450 CCTTTATTAAACAGTGACAGCAG No data
Right 1158124999 18:54091453-54091475 ACTTTGTTCTGAGTTCTAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158124997 Original CRISPR CTGCTGTCACTGTTTAATAA AGG (reversed) Intergenic
No off target data available for this crispr