ID: 1158130904

View in Genome Browser
Species Human (GRCh38)
Location 18:54151511-54151533
Sequence GGACATCAGACTGGGGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 294}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158130904_1158130917 17 Left 1158130904 18:54151511-54151533 CCCCACCCCCCAGTCTGATGTCC 0: 1
1: 0
2: 3
3: 28
4: 294
Right 1158130917 18:54151551-54151573 TGATCCAGAGATGTCCTTCATGG 0: 1
1: 0
2: 1
3: 16
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158130904 Original CRISPR GGACATCAGACTGGGGGGTG GGG (reversed) Intergenic
900200050 1:1400461-1400483 GGACAGCTGACCTGGGGGTGGGG - Intronic
903647571 1:24904406-24904428 GGACAGCAGTCTGGGTGGCGGGG + Intronic
903878529 1:26492779-26492801 GGAGGCCAGACTGGGGGGTGTGG + Intergenic
903976920 1:27156202-27156224 GGAAATCTGGCTGGGGGTTGTGG - Intronic
904275964 1:29384550-29384572 GAACATCAGACAGTGGGTTGGGG + Intergenic
905013130 1:34760287-34760309 GGACTCCAGACAAGGGGGTGTGG + Intronic
905249772 1:36640473-36640495 GTACATCAGACTGAGGAGTTTGG - Intergenic
905829297 1:41052189-41052211 GGTCTTCAGCCTGGGGGTTGGGG - Intronic
906188745 1:43881776-43881798 GTATTTCAGAATGGGGGGTGGGG + Intronic
906533978 1:46541231-46541253 GGACTTCAGACTGGCAGGAGTGG + Intergenic
907117140 1:51978812-51978834 GGGCATGAGGCTGGTGGGTGTGG + Intronic
907409590 1:54274837-54274859 GGACTGCAGGCTGGGGTGTGGGG - Intronic
907438002 1:54461930-54461952 GGAGTTCAGAGTGGGGGCTGGGG + Intergenic
909287154 1:73834364-73834386 GGACATCAGACTAGATGGGGTGG + Intergenic
910812325 1:91251401-91251423 GGACATGAGTTTGGGGAGTGAGG - Intergenic
910881320 1:91924635-91924657 GGACGTGAGACTGGTGTGTGTGG - Intergenic
911506883 1:98763958-98763980 TGACCTCAGACCTGGGGGTGGGG - Intergenic
912380599 1:109246215-109246237 AGCCAGCAGACTGGGGGATGGGG - Intergenic
912996756 1:114538333-114538355 GGACAGCTGAGTGGAGGGTGGGG - Intergenic
913124585 1:115773174-115773196 GGACATCCTGATGGGGGGTGGGG - Intergenic
914903579 1:151726219-151726241 GGAGATCAGAGTGGGGAGAGAGG - Intronic
915304240 1:154968809-154968831 GGCCATCAGTCTGGTGTGTGAGG - Exonic
915565336 1:156709795-156709817 GGACCACAGACTGGGAGGAGGGG + Intergenic
916064146 1:161122503-161122525 AGACATCAGACTGCGGGTTCGGG - Exonic
916730602 1:167563455-167563477 GGACATGATACCAGGGGGTGAGG + Intergenic
916855298 1:168743146-168743168 AGACAGCAGCCTGGTGGGTGAGG + Intergenic
917979593 1:180260672-180260694 GGTTAACACACTGGGGGGTGAGG + Intronic
918634603 1:186760011-186760033 GAACATCAGGCTTGGGGATGGGG + Intergenic
919087477 1:192937753-192937775 GGACCTCAGACAGGGGTGTATGG + Intergenic
919599730 1:199607642-199607664 GAACATCACACTCTGGGGTGCGG + Intergenic
919728701 1:200899708-200899730 GGACATCAGGCTGGGGGCTGGGG + Intronic
920523720 1:206649434-206649456 TCACAGCAGACTGTGGGGTGGGG + Intronic
922742404 1:228021436-228021458 TGAGCTCAGACTGGGGGATGCGG + Intronic
922957704 1:229618079-229618101 GGAAATCAGTCTGGGTGGAGGGG - Intronic
923153759 1:231257907-231257929 GGGCAACAGAATGGGTGGTGGGG - Intronic
923747518 1:236716305-236716327 GCACATCAAACTGGGGAGTAGGG - Intronic
924087203 1:240464729-240464751 GGACATCATGCTGTGGGGTCTGG - Intronic
1063098522 10:2929301-2929323 GGATAGCAGAGTGAGGGGTGGGG + Intergenic
1065857961 10:29845653-29845675 GGCCATCAGGCTGGGGGCTCAGG + Intergenic
1067704126 10:48594557-48594579 GGACAGCACATTTGGGGGTGGGG - Intronic
1068970923 10:62957238-62957260 GGACCTCAGCCTGGGGGATGGGG + Intergenic
1070129339 10:73646246-73646268 GGAAAGCAGAGTGGGGGGTGGGG + Exonic
1070327094 10:75396333-75396355 GGACATCAGGGTCGGGGGTGTGG + Intergenic
1071137699 10:82470910-82470932 GGACAGCAGACTGGGGAATGGGG - Intronic
1072754308 10:98008407-98008429 GTACAAAAGAGTGGGGGGTGGGG + Intronic
1072940522 10:99759768-99759790 GGACATGGGATTGGGGGGTCAGG - Intergenic
1074753761 10:116609823-116609845 GGACGCCAGACTGGCGGGTGGGG - Intergenic
1074890807 10:117735355-117735377 GGACAGGAGACACGGGGGTGAGG + Intergenic
1075648873 10:124114657-124114679 GGCCAACAGGCTGGTGGGTGGGG + Intergenic
1075681660 10:124337764-124337786 CGACATGAGATTTGGGGGTGGGG - Intergenic
1075861457 10:125680237-125680259 GAAAATCAGGCTGGGGGTTGGGG + Intronic
1076016880 10:127034883-127034905 GGACATCCCCCCGGGGGGTGGGG + Intronic
1076400947 10:130184906-130184928 GGACAGCAGGCTGGGAGATGAGG - Intergenic
1076779611 10:132717003-132717025 GGACCTCAGCCTTGGGGCTGGGG - Intronic
1076796649 10:132801585-132801607 GGACATCTGAGATGGGGGTGGGG + Intergenic
1076897500 10:133320073-133320095 GGGCATCTGAGTGGGGAGTGGGG - Intronic
1078465814 11:11549597-11549619 GGAAATCAGACTGGAAGGTCAGG - Intronic
1079349447 11:19680119-19680141 GAACATCAGGCTTGGGGGTTTGG + Intronic
1081805268 11:45886640-45886662 TAACACCAGATTGGGGGGTGGGG - Intronic
1083987378 11:66224437-66224459 GCACATCAGACTGCTGCGTGGGG + Intronic
1084323173 11:68384779-68384801 GGGCTTCAGTTTGGGGGGTGGGG - Intronic
1084399148 11:68933649-68933671 GGACATCAGAAGGGAGGGAGCGG - Intronic
1084422533 11:69067442-69067464 GGAGCTCAGCCTGTGGGGTGGGG + Intronic
1085201944 11:74707140-74707162 GGGAATCAGACTGTGGAGTGAGG - Intronic
1085535612 11:77215460-77215482 GGACATCAGGCTGGGAGGTGAGG + Intergenic
1087832011 11:102829702-102829724 GGACACTAGACTGGGGGGCAGGG - Intergenic
1087896206 11:103589664-103589686 GGACAGGAGACAGGAGGGTGGGG + Intergenic
1089133661 11:116232337-116232359 GGCCATCAGAATGGAGGCTGGGG - Intergenic
1089194600 11:116686862-116686884 GGACAGCCGGTTGGGGGGTGGGG + Intergenic
1092259461 12:6945089-6945111 TGACTTCATAGTGGGGGGTGGGG - Intronic
1097570416 12:61325419-61325441 GGACATGAGATTTGGGGGTGGGG - Intergenic
1098644298 12:72879751-72879773 GGACATGAGAGTTGGGGGTCAGG - Intergenic
1098890285 12:76003603-76003625 AGAAATCAGTCTGGGGGGTGGGG + Intergenic
1100329730 12:93571837-93571859 GGACATGGGGCGGGGGGGTGGGG - Exonic
1102038179 12:109783790-109783812 GCACATCAGAGGGAGGGGTGGGG + Intronic
1102923257 12:116808602-116808624 GAACAACAGCTTGGGGGGTGTGG - Intronic
1103056986 12:117829151-117829173 GGAGATGAGACTGGGGAGGGAGG - Intronic
1103187348 12:118970550-118970572 GGAGATCAGACTGGGAGTTATGG + Intergenic
1103272774 12:119687427-119687449 GGAGATGACGCTGGGGGGTGGGG + Exonic
1103731562 12:123031342-123031364 GGAGCTCGGACTGGGGGCTGTGG + Intronic
1103894385 12:124263582-124263604 GGGAACCAGAGTGGGGGGTGGGG - Intronic
1104092252 12:125526750-125526772 GGACACCAGGGTGGGGGCTGAGG + Intronic
1104931396 12:132341244-132341266 CGACATCTGACTTGGGGTTGGGG + Intergenic
1108065950 13:46577846-46577868 TGACAGCAGTCTGGAGGGTGGGG - Intronic
1110173641 13:72531672-72531694 GGAAATGAAAATGGGGGGTGAGG + Intergenic
1112857114 13:103785861-103785883 GGATATGATATTGGGGGGTGGGG - Intergenic
1113784923 13:112997438-112997460 GGACAGCAGAGTGGGGGGCATGG + Intronic
1114270387 14:21097507-21097529 GGTCCTCAGACTGGGAGGTAGGG + Intronic
1114646091 14:24257051-24257073 GGACATCAGGCAGGGGGCTCAGG - Intronic
1115332425 14:32212663-32212685 GTACTTCAGAATGGGGGGGGTGG + Intergenic
1115805227 14:37043404-37043426 GGAGCTCAGACTGGAGTGTGTGG - Intronic
1116232024 14:42229475-42229497 CCACATCAGTCTGGAGGGTGGGG + Intergenic
1118338838 14:64878781-64878803 ATGCATCAGATTGGGGGGTGGGG - Intronic
1118674542 14:68169578-68169600 AGATATCAGACTGGGGGAGGAGG - Intronic
1118694430 14:68370636-68370658 GTGGCTCAGACTGGGGGGTGTGG + Intronic
1119468870 14:74881449-74881471 GGACCTGAGACTGGGGGTGGGGG + Intergenic
1119761726 14:77156516-77156538 GAACAAGAGACTGGGGGCTGGGG - Intronic
1121680952 14:95792368-95792390 GGACATCAGCATGGTGGATGGGG + Intergenic
1122258603 14:100499028-100499050 TGACTTCAGAATGGAGGGTGAGG + Intronic
1122994260 14:105254117-105254139 GGACACAAGGTTGGGGGGTGTGG - Intronic
1127373283 15:58359843-58359865 GGACATGAGACTGGGGGAGGAGG - Intronic
1128498080 15:68209608-68209630 GGACATCAGCATGGGGGCAGAGG - Intronic
1128982852 15:72199139-72199161 GGACAGCTGAGTGGAGGGTGGGG + Exonic
1129253030 15:74319103-74319125 GCAGCTCAGACTGGGGGCTGGGG + Intronic
1129660969 15:77552703-77552725 GGCCCTCACACTGCGGGGTGTGG + Intergenic
1130387325 15:83423229-83423251 GAACATCAGACTGTGTGGAGTGG + Intergenic
1130421917 15:83756600-83756622 GGACATGAGATTTGGGGGGGGGG - Intronic
1130475362 15:84261457-84261479 GGACATGATGCTGGGAGGTGTGG + Intergenic
1130482779 15:84375511-84375533 GGACATGATGCTGGGAGGTGTGG + Intergenic
1131482012 15:92790435-92790457 GCACATCAGACTGGGCACTGTGG + Intronic
1131645644 15:94339188-94339210 AGACATTAGCCTGGGGAGTGGGG + Intronic
1132279465 15:100600961-100600983 GGTAATGAGACTGGGGAGTGGGG - Intronic
1132865101 16:2089406-2089428 GGACATCTGCCCAGGGGGTGGGG + Exonic
1133018809 16:2956939-2956961 GGAGATCATGCTGGGGTGTGGGG + Intergenic
1133259500 16:4538817-4538839 GGACGTCACGGTGGGGGGTGGGG + Intronic
1133481971 16:6179513-6179535 GGACTTCAGACTGTGAGATGAGG - Intronic
1133568622 16:7019840-7019862 GGACCACAGATTGGGAGGTGTGG - Intronic
1135496735 16:22958418-22958440 GTACATCAGACAGAGGAGTGGGG - Intergenic
1135906047 16:26512810-26512832 GGACATCAGGCTGGGTTGTATGG - Intergenic
1136381661 16:29898914-29898936 GGACATGAGACTGTGGGGGTGGG - Intronic
1137805180 16:51297861-51297883 GGGCATCAGAATGAGGAGTGGGG + Intergenic
1140934092 16:79654686-79654708 GGACAATAGTTTGGGGGGTGGGG - Intergenic
1141652538 16:85401347-85401369 GGCCATCAGAGTGGGTGGGGTGG + Intergenic
1141662388 16:85448512-85448534 GGACATGAGACTGAGAGATGAGG + Intergenic
1142904604 17:3033618-3033640 GGACATCACACTGGGAGGTCAGG - Exonic
1143386938 17:6536563-6536585 GGACATGTGGCTGGGAGGTGGGG - Intronic
1146397698 17:32481776-32481798 GGAAATGAGACTGTGGGGTGTGG + Exonic
1146821122 17:35984302-35984324 ACACATCACACTGGGGGGAGAGG - Intronic
1147384406 17:40072893-40072915 GGACAGGAGACTGGGGTGGGGGG - Intronic
1148141658 17:45333438-45333460 GGAGATGAGAATGGGAGGTGAGG + Intergenic
1148452045 17:47785198-47785220 TCACATCAGACTGTGGTGTGTGG - Intergenic
1149239368 17:54631155-54631177 GGACATGAGATTGGGGGAGGGGG - Intergenic
1149492683 17:57096473-57096495 GGCCATCACAATGGAGGGTGGGG + Intronic
1150486735 17:65549381-65549403 GGACATCAGTTTGGTGGGAGGGG - Intronic
1151257599 17:72891080-72891102 GGATATCAGGTTGGGGGGTGGGG + Intronic
1151336943 17:73445606-73445628 GGAGAGCAGACGGAGGGGTGAGG + Intronic
1151427572 17:74040948-74040970 GGACATCACACAGCGTGGTGGGG - Intergenic
1151945672 17:77318675-77318697 GGACATCTTCCTGGGGGGTGGGG - Intronic
1152343524 17:79738107-79738129 GGACATCAGGGTGGAGGGTCAGG - Intronic
1152352474 17:79791387-79791409 GGAGAGCAGAGTGCGGGGTGGGG - Intergenic
1152597617 17:81245675-81245697 GGACATCAGGCAGGGGGTTAAGG + Exonic
1152741386 17:82019953-82019975 GGTCACCACCCTGGGGGGTGCGG - Intronic
1152797453 17:82315225-82315247 GGACAGCAGGGTGAGGGGTGTGG + Exonic
1153138340 18:1942930-1942952 GCACATGAGATTGGGGGGTCAGG + Intergenic
1153620704 18:6975027-6975049 GGAAATCAGACTGGGGGGCGAGG + Exonic
1155270736 18:24139218-24139240 GGTCCTCAGAGTCGGGGGTGGGG + Intronic
1155436053 18:25814152-25814174 GGTCATCAGCCTTGGGAGTGAGG + Intergenic
1156334783 18:36160075-36160097 AGACATCAGATTGTGGGGTGGGG - Intronic
1156474074 18:37394739-37394761 AGACAGCAGACTGCTGGGTGTGG - Intronic
1156539814 18:37898452-37898474 GGACATCTGTCAGGGTGGTGTGG + Intergenic
1158130904 18:54151511-54151533 GGACATCAGACTGGGGGGTGGGG - Intergenic
1158327909 18:56330069-56330091 AATCATCTGACTGGGGGGTGTGG - Intergenic
1158437626 18:57444553-57444575 GAACCTCACCCTGGGGGGTGGGG - Intronic
1160077624 18:75693311-75693333 GTACATCAGATTGGGTGGTTGGG - Intergenic
1160101400 18:75923090-75923112 GGAAATCCTGCTGGGGGGTGAGG + Intergenic
1160143288 18:76345407-76345429 GGCCAACAGAATGGGGTGTGTGG + Intergenic
1160251950 18:77210515-77210537 GGTCCTCTGGCTGGGGGGTGGGG + Intergenic
1161345765 19:3768139-3768161 GGACAGAGGACTTGGGGGTGGGG - Intronic
1163167156 19:15506362-15506384 GGAGATCATACTGCTGGGTGGGG - Intergenic
1165288967 19:34867833-34867855 GGACACCACACTAGGGGGAGGGG - Intergenic
1165450306 19:35878563-35878585 TGAGATCAGACTTGGGGGTAGGG + Exonic
1165823653 19:38693188-38693210 GAGCATCAGCCTGGTGGGTGGGG + Intronic
1166214225 19:41325234-41325256 GGACAGGAGACACGGGGGTGGGG - Intronic
1166587395 19:43961642-43961664 GGACTTTGGACTGGGGGATGGGG - Intronic
1166850598 19:45758846-45758868 GAACAGCAGACTCAGGGGTGTGG - Intronic
1167209391 19:48123545-48123567 GAGCATCAGACGGGGGGCTGCGG + Intronic
1167467480 19:49657987-49658009 GGAGGTCAGTCTGGGAGGTGAGG + Intronic
1167552252 19:50169257-50169279 GGACAGGAAACTGGGGTGTGAGG + Intergenic
1167615161 19:50528950-50528972 GGGCATGAGGCTGGGGGCTGTGG + Intronic
1168444464 19:56399869-56399891 GGCCATCAGTCTGGGAGGAGAGG - Intronic
925821936 2:7807303-7807325 GGACCTCAGCTTGGGGGGTTGGG + Intergenic
930447725 2:51496372-51496394 GAACATCACACTGGGGCCTGTGG - Intergenic
933009110 2:77035215-77035237 GGACATCACACACCGGGGTGGGG - Intronic
934493117 2:94775745-94775767 GGACATGAGATTGGGGAGGGGGG - Intergenic
935233584 2:101119572-101119594 TGACATCAGACTCTGGAGTGGGG - Intronic
935252171 2:101273224-101273246 GGACAGCAGGCAGGGGGCTGCGG + Intronic
935268619 2:101415031-101415053 GGCCAGCAGACACGGGGGTGGGG - Intronic
936383924 2:112012032-112012054 GGTAACTAGACTGGGGGGTGTGG + Intronic
937269445 2:120638815-120638837 GGTCATCAGCCTGGATGGTGAGG - Intergenic
939110379 2:137999538-137999560 GGTCATAAGACTGGGAGGTCTGG - Intronic
940978412 2:159973458-159973480 GGTCATGAGGGTGGGGGGTGGGG + Intronic
944129483 2:196331477-196331499 GCACATCTTACTGGGGCGTGTGG - Intronic
944814238 2:203359125-203359147 GTAGGTCAGACTGTGGGGTGTGG + Intronic
944981054 2:205120427-205120449 GCACTTCAGAAAGGGGGGTGCGG + Intronic
947928026 2:233938330-233938352 GGAAAGCAGACTGGGGGGAGTGG - Intronic
948626216 2:239269980-239270002 GGACATCATTTTGGGGGGCGGGG - Intronic
948793529 2:240391029-240391051 GGATTCCAGCCTGGGGGGTGGGG + Intergenic
949004121 2:241635970-241635992 GGACATCGGAATTGGGGGTGGGG - Intronic
1169628254 20:7597058-7597080 AGACAGTAGACTAGGGGGTGGGG + Intergenic
1170077176 20:12432498-12432520 GGGCAGCATGCTGGGGGGTGGGG - Intergenic
1171276132 20:23857961-23857983 GGGGGTCAGATTGGGGGGTGGGG - Intergenic
1172767763 20:37359779-37359801 GAAGAGCAGACTGGGGGCTGAGG + Intronic
1173755850 20:45515475-45515497 GGGAATCAGGCTGGGGGGCGGGG - Intronic
1175372016 20:58498675-58498697 GGTTATCAGGCTGGGAGGTGTGG - Intronic
1179275159 21:39885451-39885473 GGACATCAGGCTGGCGGCTGGGG + Intronic
1179939623 21:44629120-44629142 GGTCACCAGTGTGGGGGGTGTGG - Intronic
1184411054 22:44326713-44326735 GGAGAGCAGGCTGGGGGGTATGG + Intergenic
1184673210 22:46026536-46026558 GGACATCAGACTCTGGGTTGTGG + Intergenic
1184762286 22:46551434-46551456 GGACAGCAGGCTGGAGGATGAGG - Intergenic
1185137377 22:49080466-49080488 GGACATCAGAATGGCAGGTTAGG + Intergenic
1185346703 22:50313594-50313616 GGACATGGGACTGGGGGGCACGG - Intronic
949693632 3:6668441-6668463 GGACATGAGATTTGGGGGGGGGG + Intergenic
950075849 3:10186480-10186502 GCACATTAAATTGGGGGGTGAGG - Intronic
950438056 3:12992470-12992492 GGGCATCATACTGGGGGCAGGGG + Intronic
950568119 3:13783383-13783405 GGGCATCAGAGTTGGGGGAGGGG + Intergenic
951707517 3:25558242-25558264 GGAAGCCAGACTTGGGGGTGGGG - Intronic
952890309 3:38035950-38035972 GGACATCTGACTGGGCGCAGTGG + Intergenic
953595545 3:44309318-44309340 TGAGATCAGCCTGGGGAGTGTGG - Intronic
953841921 3:46396056-46396078 GGTCTTCAGTCTGGGTGGTGAGG - Intergenic
954415571 3:50391654-50391676 TGACCTCAGCCTGGGGGGTTGGG - Intronic
957079208 3:75622745-75622767 GAACATCATCCTTGGGGGTGTGG - Intergenic
960542073 3:118872094-118872116 GGACATGAGATTTGGGGGTGGGG + Intergenic
961697702 3:128717276-128717298 GGAGCTCAGACTGGGTGCTGGGG + Intergenic
962310154 3:134320552-134320574 AGGAATCAGACTGGGGGGTGGGG - Intergenic
962828594 3:139120593-139120615 GGACATCTGGCTGAGGGGCGGGG + Intronic
963129474 3:141845246-141845268 GGACAGCAGACAAGGCGGTGGGG - Intergenic
966032358 3:175366024-175366046 GAACATCACACTCTGGGGTGGGG - Intronic
966098638 3:176239068-176239090 GGCCATCAGGGTGGGGGGAGGGG - Intergenic
968192307 3:196677577-196677599 GGACATCAGATTTGAGGATGTGG - Intronic
968546134 4:1199969-1199991 GGGCTTCAGGCTGGGGGGAGAGG - Intronic
968755541 4:2414039-2414061 GGGCCCCAGAGTGGGGGGTGGGG - Intronic
968944181 4:3654964-3654986 GGTCATCAGACTTGGGTTTGAGG - Intergenic
969393743 4:6907704-6907726 GCACATCAGAGATGGGGGTGAGG + Intergenic
970601987 4:17647853-17647875 GGACAACAGTCTCTGGGGTGGGG + Intronic
973816815 4:54626830-54626852 GGACTTGAGACTGGGGATTGGGG - Intergenic
976526673 4:86099740-86099762 GTACAGGAGACTGGGGGGTGGGG - Intronic
979321750 4:119332822-119332844 GAACAAAAGACTAGGGGGTGTGG - Intergenic
980233120 4:130069490-130069512 GAACATCACACTCTGGGGTGGGG - Intergenic
981382572 4:144090402-144090424 GGGTATAGGACTGGGGGGTGTGG - Intergenic
982825503 4:159999433-159999455 GGACATCAGACAGAGGTCTGTGG + Intergenic
983239727 4:165218425-165218447 GAACAAAAGACTAGGGGGTGTGG - Intronic
984374623 4:178911840-178911862 GAACATCAGACAGGGGGAAGTGG + Intergenic
985549533 5:525940-525962 TGACATCTGAGTGGGGGCTGCGG + Intergenic
985972529 5:3389675-3389697 GGACTGCAGACTGGGAGGTGTGG - Intergenic
986192410 5:5509621-5509643 GGACATCAGAGTGGGAGTTGAGG + Intergenic
989210638 5:38855713-38855735 GGACAACAGGTGGGGGGGTGTGG - Intronic
992813056 5:80408332-80408354 GGACATCAGATTGGAGGGCCAGG - Intronic
997463701 5:134072523-134072545 GGACAGCACACTGGGGGGAAAGG + Intergenic
998029862 5:138857010-138857032 GGGCAGCAGACTGGGGCATGAGG - Intronic
998915680 5:147008667-147008689 GGACATAGGAGTGGGGGGTGGGG - Intronic
999255257 5:150206492-150206514 GGTAAGCAGACTGTGGGGTGGGG - Intronic
999312378 5:150559754-150559776 GGACATCCCCGTGGGGGGTGAGG - Intergenic
1000311739 5:160051659-160051681 AGAAATCAGACTGGGGGTAGGGG + Intronic
1001977185 5:176009763-176009785 GGTCTTCAGGCTGGAGGGTGGGG - Intronic
1002240240 5:177834017-177834039 GGTCTTCAGGCTGGAGGGTGGGG + Intergenic
1002888624 6:1316464-1316486 GGACATCACACTGGGCGGGCGGG + Intergenic
1003058202 6:2841706-2841728 GGGCCTGAGCCTGGGGGGTGGGG + Intronic
1004050277 6:12071099-12071121 GAACATGAGACTAAGGGGTGGGG - Intronic
1004126804 6:12882060-12882082 GGGCATTTGACTGGGGGCTGGGG + Intronic
1004326363 6:14677382-14677404 GGACAGCAAACAGGTGGGTGTGG - Intergenic
1004591816 6:17059387-17059409 GGACATCAGCGAGGAGGGTGGGG - Intergenic
1006653387 6:35569468-35569490 GGGCACCAGACTGGGCGGGGTGG + Intergenic
1008927116 6:56898631-56898653 GCACATCAGACTGGTGGGTTGGG - Intronic
1009000482 6:57707055-57707077 GGACGGGAGAGTGGGGGGTGAGG - Intergenic
1009188949 6:60606482-60606504 GGACAGGAGAGTGGGAGGTGAGG - Intergenic
1009245379 6:61231200-61231222 AGACATTAGACTGGGGCGGGAGG + Intergenic
1011775798 6:90729128-90729150 GGAGGTCAGACTGGGGCCTGGGG + Intergenic
1013326763 6:109053593-109053615 GGAGATGAGACTGGGAGATGAGG + Intronic
1014074162 6:117217434-117217456 GGAAGTCAGACTGGTAGGTGGGG - Intergenic
1015294022 6:131569915-131569937 TGACACCATACTGGTGGGTGGGG + Intergenic
1017757542 6:157542363-157542385 GGGCGTCATACTGGGGAGTGGGG + Intronic
1018916486 6:168135514-168135536 TGACATCAGAGTGGGCGGAGGGG + Intergenic
1019533330 7:1514596-1514618 GGTCTTCAGAGTGGGGGCTGCGG - Intergenic
1019552646 7:1610749-1610771 AGACCGCAGCCTGGGGGGTGGGG + Intergenic
1019570973 7:1711990-1712012 GGACAGCAGACTGGGCTGTGCGG + Intronic
1020001533 7:4759068-4759090 GGACATCAGCCCGGGGTGTGTGG - Exonic
1020111958 7:5452368-5452390 TGCCACCAGACTGCGGGGTGTGG - Intronic
1020169429 7:5833494-5833516 AGACATCAGAGTGGGGAGAGAGG - Intergenic
1020754206 7:12181485-12181507 GAACATCACACTCTGGGGTGGGG - Intergenic
1021249316 7:18304899-18304921 GGACAGCAGAGGTGGGGGTGGGG - Intronic
1022695833 7:32704695-32704717 AGACACCAGACTGTGGGGTAGGG + Intergenic
1023377715 7:39575171-39575193 AGACATTAGACTGAGTGGTGTGG + Intronic
1024512280 7:50213347-50213369 GGGCATCAGCCTGGGCAGTGGGG + Intergenic
1025208751 7:57008909-57008931 GGACATCAGGATGGCAGGTGGGG - Intergenic
1027236938 7:76303764-76303786 GGAAATCAGACTGCGGGGGAGGG - Intronic
1027246902 7:76373658-76373680 GGCCATGAGACTGGGGGATAAGG + Intergenic
1028166229 7:87541065-87541087 GGACTTCAAAATGGGGTGTGGGG - Intronic
1028754937 7:94423880-94423902 GGAAATCAGGCTGGGTGGGGTGG - Intronic
1029513047 7:101008779-101008801 GGACATCACCCTGGGGTGTCTGG - Intronic
1030713547 7:112782846-112782868 GTACATCAGACTGGGATGTGGGG - Intronic
1031745067 7:125485560-125485582 TAATATGAGACTGGGGGGTGAGG + Intergenic
1031952511 7:127906765-127906787 GGATACCACACTGAGGGGTGTGG - Intronic
1032011324 7:128350077-128350099 GGACATCGCCCTGGGAGGTGAGG - Intergenic
1032261868 7:130344724-130344746 GGCTATCCTACTGGGGGGTGTGG + Intergenic
1033527748 7:142232905-142232927 GGTCTTCAGACTTGAGGGTGGGG + Intergenic
1035976733 8:4320926-4320948 GGACCTCACACTGGGAGGAGAGG - Intronic
1037108909 8:15142664-15142686 TGAGATGAGATTGGGGGGTGGGG - Intronic
1037582673 8:20254858-20254880 GGGCATGAGCTTGGGGGGTGTGG + Exonic
1039404100 8:37298022-37298044 GGACATAAGACTGGGCAGAGAGG - Intergenic
1041351286 8:56950426-56950448 GGACATGAGGCTGGGTGCTGTGG - Intergenic
1041367546 8:57124589-57124611 TGGCATCATACTGGAGGGTGTGG + Intergenic
1044973218 8:97639912-97639934 GAACATCAGGGTGGGGGCTGGGG - Intergenic
1045278363 8:100727186-100727208 GCACTTCAGCCTGGGGGATGGGG - Intergenic
1047332991 8:123909251-123909273 GGACATGAGTGTGTGGGGTGGGG + Intronic
1049244825 8:141556696-141556718 TGAAAGCAGACTGGGGGATGCGG - Intergenic
1049579434 8:143404657-143404679 TGACCTCAGCCCGGGGGGTGGGG - Intergenic
1049839103 8:144759249-144759271 GGCAATCAGACTGGGGGCCGGGG + Intergenic
1052341276 9:27366587-27366609 GTCCAGGAGACTGGGGGGTGGGG + Intronic
1053455119 9:38227508-38227530 GGAAATAGGACTGGGGGGTTGGG + Intergenic
1058912866 9:109536937-109536959 CGACTTCATATTGGGGGGTGGGG - Intergenic
1059989239 9:119848991-119849013 AGACATCAGACTGGGTGCAGTGG - Intergenic
1060252624 9:121998202-121998224 GGACATAGGACTGTGGTGTGGGG - Intronic
1060445171 9:123680935-123680957 GGACATCAGACTCAGGTGAGGGG + Intronic
1061917983 9:133766598-133766620 GAACATCACACTGGAGGGGGAGG + Intronic
1186781341 X:12915364-12915386 GGACACCAGACTGGGCCATGTGG - Intronic
1187010428 X:15273028-15273050 GGACATCTAAGTGAGGGGTGGGG - Intergenic
1187126036 X:16455368-16455390 GGACTTCAGGCTGAGGGGAGAGG - Intergenic
1187148618 X:16660843-16660865 TGACATCAGACTGTTGGCTGAGG - Intronic
1187243962 X:17537759-17537781 TGACATCAGCCTGGCGGGTCAGG - Intronic
1187261203 X:17686732-17686754 AGAGATGAGACTGGGAGGTGGGG + Intronic
1188010391 X:25049135-25049157 GGAAATCACACCTGGGGGTGAGG + Intergenic
1188898520 X:35699075-35699097 GGCCATCAGGCTGGAGGGAGGGG - Intergenic
1189687402 X:43579569-43579591 AGAGATCAGATTGGAGGGTGGGG - Intergenic
1190508402 X:51152190-51152212 GGAGATCAGATCGGGGGTTGCGG - Intergenic
1192587359 X:72329584-72329606 GATCAGCAGACTGGGAGGTGGGG - Exonic
1193163175 X:78252367-78252389 GGAAATCTTAGTGGGGGGTGGGG - Intergenic
1194229779 X:91307468-91307490 AGACAGTGGACTGGGGGGTGGGG - Intergenic
1194438165 X:93894803-93894825 AGACAGTGGACTGGGGGGTGGGG - Intergenic
1195314496 X:103664761-103664783 GGGCATGAGAGTGGTGGGTGGGG + Intergenic
1195390086 X:104352646-104352668 GGACACCTGTCTGAGGGGTGGGG + Intergenic
1196014256 X:110920634-110920656 GGACTGCAGCCTGCGGGGTGTGG - Intergenic
1196748923 X:119097043-119097065 GGACATCTGGCTGGGGTGAGAGG + Intronic
1198699525 X:139382388-139382410 CGATCTCAGAGTGGGGGGTGGGG - Intergenic
1199965743 X:152819205-152819227 GGACATCATTCTGGGGGGCATGG - Intergenic
1200691024 Y:6306425-6306447 GGGCATCAGGCTTCGGGGTGGGG + Intergenic
1201044248 Y:9868291-9868313 GGGCATCAGGCTTCGGGGTGGGG - Intergenic