ID: 1158131155

View in Genome Browser
Species Human (GRCh38)
Location 18:54153793-54153815
Sequence TTTCCTTGAAGCAGTCCTGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 195}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158131155_1158131157 -9 Left 1158131155 18:54153793-54153815 CCAGCAGGACTGCTTCAAGGAAA 0: 1
1: 0
2: 2
3: 9
4: 195
Right 1158131157 18:54153807-54153829 TCAAGGAAACTAATGGCCCTAGG 0: 1
1: 0
2: 0
3: 8
4: 128
1158131155_1158131159 -2 Left 1158131155 18:54153793-54153815 CCAGCAGGACTGCTTCAAGGAAA 0: 1
1: 0
2: 2
3: 9
4: 195
Right 1158131159 18:54153814-54153836 AACTAATGGCCCTAGGGTCCAGG 0: 1
1: 0
2: 0
3: 6
4: 65
1158131155_1158131160 -1 Left 1158131155 18:54153793-54153815 CCAGCAGGACTGCTTCAAGGAAA 0: 1
1: 0
2: 2
3: 9
4: 195
Right 1158131160 18:54153815-54153837 ACTAATGGCCCTAGGGTCCAGGG 0: 1
1: 0
2: 1
3: 6
4: 71
1158131155_1158131158 -8 Left 1158131155 18:54153793-54153815 CCAGCAGGACTGCTTCAAGGAAA 0: 1
1: 0
2: 2
3: 9
4: 195
Right 1158131158 18:54153808-54153830 CAAGGAAACTAATGGCCCTAGGG 0: 1
1: 0
2: 0
3: 7
4: 93
1158131155_1158131164 22 Left 1158131155 18:54153793-54153815 CCAGCAGGACTGCTTCAAGGAAA 0: 1
1: 0
2: 2
3: 9
4: 195
Right 1158131164 18:54153838-54153860 ATCAAAGTTGAGCGTAAATCAGG 0: 1
1: 0
2: 0
3: 4
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158131155 Original CRISPR TTTCCTTGAAGCAGTCCTGC TGG (reversed) Exonic
903115722 1:21176884-21176906 TTTCCGAGCAGCCGTCCTGCCGG - Intronic
904412286 1:30331705-30331727 CGTCCTTGAACCATTCCTGCTGG + Intergenic
904874582 1:33644260-33644282 TTTCCTTGGAGAAGACCTGGGGG + Intronic
904973961 1:34441805-34441827 TTTACGTGAAGCAGCTCTGCGGG - Intergenic
905959895 1:42035295-42035317 TTCCCTTCCAGAAGTCCTGCCGG - Intronic
906249515 1:44300645-44300667 TTTCCTAGATGCAGGCCTGAGGG - Intronic
910189397 1:84579899-84579921 TTTCCATGAAGCAGAGCTGCTGG - Intergenic
910338946 1:86164044-86164066 TCTCCTTGAAGAGGTCCTTCAGG + Intergenic
910658923 1:89649679-89649701 TTTCCTTGAAACATTCTTTCAGG + Intronic
912541223 1:110417432-110417454 TTTCCTGGAAACAGTAGTGCAGG - Intergenic
913020650 1:114786021-114786043 TCTCCTTGAAGAGGTCCTTCAGG + Intergenic
916178457 1:162062859-162062881 TTTTCTTGAAACAGTGCTGGAGG - Intergenic
918445323 1:184611541-184611563 TGTCCTTGAACCAGGACTGCAGG - Intronic
921164209 1:212494436-212494458 GATCCTTGAGGAAGTCCTGCTGG + Intergenic
921553306 1:216566106-216566128 TTACCTAGAAACAGTGCTGCCGG - Intronic
1063533548 10:6860488-6860510 TCTCCTTGAAGAGGTCCTTCAGG - Intergenic
1067353639 10:45502766-45502788 TTTCTTTTAAGCAGTTCTGTTGG - Intronic
1067492201 10:46720309-46720331 CTGCCTTGAAGCAGACATGCAGG + Intergenic
1067602461 10:47620075-47620097 CTGCCTTGAAGCAGACATGCAGG - Intergenic
1069304630 10:66953526-66953548 TTTGCTTGAAACAGTCTTACTGG + Intronic
1069460972 10:68594449-68594471 ATTCCTTCCAGCAGTTCTGCTGG - Intronic
1069795430 10:71048890-71048912 GATCCTTGGAGCAGTCCTGAGGG + Intergenic
1071006101 10:80885893-80885915 TCTCCTTGAAGAGGTCCTTCAGG - Intergenic
1071194367 10:83140610-83140632 TTTCCTAGAATCTGTCCTGGGGG - Intergenic
1071366244 10:84903331-84903353 TTTGCCTGAAGCTGTCCTGGAGG - Intergenic
1071653814 10:87425487-87425509 CTGCCTTGAAGCAGACATGCAGG - Intergenic
1073138110 10:101230672-101230694 TTTCCCTGAGGCATTCCAGCAGG + Intergenic
1074487742 10:113903882-113903904 TATCCTTAAAGCAGTCCTGCTGG - Intronic
1074594472 10:114848808-114848830 TTTCCTTGGAGCAGTGGTGGTGG - Intronic
1074883897 10:117679859-117679881 TTTCGCAGAAGCAGTTCTGCTGG - Intergenic
1075282135 10:121148277-121148299 TTTTCCGGAAGCTGTCCTGCAGG + Intergenic
1076031598 10:127163817-127163839 TTGCCCTGAAGCAATCCTGGTGG + Intronic
1076060802 10:127412650-127412672 TTTACTTGAGGCAACCCTGCTGG - Intronic
1077721243 11:4631415-4631437 TCTCCTTGAAGAGGTCCTTCAGG - Intergenic
1077907238 11:6544131-6544153 TTTCCTGGATGGAATCCTGCAGG - Exonic
1078327091 11:10389565-10389587 TTTCCTTGAACCCTTCCTGTGGG + Intronic
1081887800 11:46514130-46514152 CTTCTTTAAAGCAGACCTGCAGG + Intronic
1084589093 11:70079703-70079725 CCTGCTTGAAGCAGCCCTGCTGG - Intronic
1084740505 11:71136253-71136275 TTTCCTTGATCCAGTCTTGGTGG - Intronic
1085490569 11:76913003-76913025 TTTGCTTGAAGGAGACCTGAAGG + Intronic
1085505422 11:77056124-77056146 TTTCCAGGAACCAGCCCTGCAGG - Intergenic
1087293835 11:96346613-96346635 TCTCCTTGAAGAGGTCCTTCAGG + Intergenic
1088134502 11:106538033-106538055 TTTCCTTGAAACAAACCTTCTGG + Intergenic
1088915831 11:114227124-114227146 TCGCCTTGCTGCAGTCCTGCTGG - Intronic
1089612553 11:119677576-119677598 TTTCCTTGAAGCGGTCCATGTGG + Exonic
1090947998 11:131448670-131448692 TGTCCTTGAGGCACTCCTCCAGG + Intronic
1091327966 11:134706061-134706083 TTTCCTTGGATCAGCCCCGCTGG - Intergenic
1091599356 12:1908599-1908621 TGTCCGTGACGCAGTCCTGGGGG - Intronic
1093231482 12:16549132-16549154 TTTTCTTAATGCAGCCCTGCTGG - Intronic
1094745831 12:33343233-33343255 TTACCCTGAAACAGTTCTGCTGG - Intergenic
1095139917 12:38649005-38649027 TTTCCATGAAACAGGCCTGCTGG - Intronic
1095988867 12:48019949-48019971 TTTCCTAGAAGCAGAATTGCTGG + Exonic
1097812610 12:64034969-64034991 TATCATTGTAACAGTCCTGCTGG + Intronic
1098255227 12:68610000-68610022 TTTTCTTGAAGCAGTTTTGATGG - Intergenic
1099235298 12:80076369-80076391 TCTCCTTGAAGAGGTCCTTCAGG + Intergenic
1100094714 12:91019028-91019050 TTTCTTGCAAGCAGACCTGCTGG - Intergenic
1100282007 12:93127236-93127258 TTGCCTCCAAGCTGTCCTGCAGG + Intergenic
1107483698 13:40806519-40806541 ATTCCATGTAGCAGTGCTGCAGG + Intronic
1107527482 13:41247674-41247696 TTTCCTAGAGGCAGTTCTGGTGG + Intronic
1107899603 13:44998659-44998681 TTTCCTAGAAGCAGTGATGTAGG - Intronic
1108548722 13:51522048-51522070 TGTACATGAAGCTGTCCTGCAGG - Intergenic
1109385514 13:61624672-61624694 TCTCCTTGAAGAGGTCCTCCAGG + Intergenic
1110136539 13:72074210-72074232 CCTCCTTGAAGCCGTGCTGCTGG - Intergenic
1110360612 13:74620764-74620786 ATTCTTTGAAGCAGTCCTCATGG + Intergenic
1110381623 13:74858100-74858122 TCTCCTTGAAGAGGTCCTTCAGG + Intergenic
1110696267 13:78494474-78494496 TTTCCTTGTAGCAGGCATGGTGG - Intergenic
1110955203 13:81545628-81545650 TTTCATTGACTCAGTTCTGCAGG + Intergenic
1111034007 13:82646588-82646610 TTTGCTTAAACCAGTCCTGTGGG - Intergenic
1111344870 13:86938614-86938636 TTTCCTTGAAGCAGGGGTGTGGG - Intergenic
1112332569 13:98487810-98487832 GGTCCTGGAAGCAGACCTGCTGG + Intronic
1112604990 13:100895772-100895794 TTCCCCTGAAGAAGTCCTGCTGG + Intergenic
1112697782 13:101969906-101969928 TTTCTTTTAAGTATTCCTGCCGG + Intronic
1113060823 13:106321026-106321048 TTTCTTTGAGAAAGTCCTGCAGG + Intergenic
1113262665 13:108582554-108582576 GTTCCCGGAAGCAGTGCTGCAGG + Intergenic
1113362255 13:109642452-109642474 TTTCCATGAAGCAGTCAGCCCGG + Intergenic
1115542571 14:34435924-34435946 TTCATTTTAAGCAGTCCTGCCGG - Intronic
1117481514 14:56150250-56150272 TTTCCTTCAAGCTGGCATGCTGG - Intronic
1118617730 14:67586413-67586435 CTTCCTTGCAGCAGTCCTCAAGG + Intronic
1121125078 14:91400570-91400592 ATTCCCTCAGGCAGTCCTGCTGG + Intronic
1121165908 14:91799017-91799039 TTTCCTTGAAGAAGAACTACTGG + Exonic
1121278016 14:92680844-92680866 TTTCCTTGCAGCAGGCGTGTGGG + Intronic
1124080507 15:26490422-26490444 TTTCCCAGAAGCAGTCCATCTGG + Intergenic
1124431457 15:29612293-29612315 TTTCCTTGAAGCTGGCCCCCAGG + Intergenic
1127632946 15:60843120-60843142 TTTCCTTGCAGCAGAACAGCAGG - Intronic
1128890595 15:71328397-71328419 TTTCCTACAAGCAGTCATTCAGG + Intronic
1131308134 15:91264015-91264037 TGTCCCAGGAGCAGTCCTGCTGG + Intronic
1131513163 15:93060780-93060802 TCTCCCTGCAGCACTCCTGCCGG + Intronic
1132837478 16:1961572-1961594 CTTCCTTGATACAGTTCTGCTGG - Exonic
1132900311 16:2250545-2250567 TGTCCTGGAAGCAGAACTGCTGG + Intronic
1141744406 16:85915832-85915854 TGTCCTTGAATTAGTCCAGCAGG + Intronic
1143393749 17:6575975-6575997 TTTCCTTGAACCAGACCTGCAGG - Intergenic
1143701589 17:8664719-8664741 TTTCCATGTCGCAGTCTTGCAGG + Intergenic
1145735666 17:27229541-27229563 TTTACTTGAAAAAGTCCTGTTGG - Intergenic
1147372852 17:40005482-40005504 TCTCCATGTAGCAGTCCTTCTGG + Intergenic
1148237115 17:45976336-45976358 TTGCCTTGAAACAGTTGTGCTGG + Intronic
1148875766 17:50686318-50686340 TTTCCTCGCAGCAGTTCAGCTGG + Intronic
1149329833 17:55569347-55569369 TTGGCTTCAAGCAGTCCTCCTGG + Intergenic
1149361638 17:55901617-55901639 CTTTCTTGAAGCATTCCTGTTGG + Intergenic
1154334661 18:13455949-13455971 ATTCCATGTAGAAGTCCTGCCGG + Intronic
1156703261 18:39849967-39849989 TTTCCTAGAATCAGTGCTGGAGG + Intergenic
1157973909 18:52303428-52303450 TTGCCTTGAAGAAATCCTGAAGG + Intergenic
1158131155 18:54153793-54153815 TTTCCTTGAAGCAGTCCTGCTGG - Exonic
1158471981 18:57745235-57745257 TTTCATTGAAGTATTCCTGTTGG - Intronic
1158529682 18:58247760-58247782 TTTCCGTGAAGCTGCCCTCCGGG + Intronic
1162605027 19:11700064-11700086 TTCCCTTTCAGCAGTCCAGCTGG + Intergenic
925941295 2:8822232-8822254 TTTTTTTAAAGCAGTCCTTCTGG + Intronic
927385009 2:22522682-22522704 TCTCCTTGAAGAGGTCCTTCAGG - Intergenic
928038996 2:27854717-27854739 TTTGATTGAACCAGTGCTGCAGG - Intronic
928440655 2:31289332-31289354 TTGGGTTGAAGCAGTCCTTCTGG - Intergenic
929399036 2:41558703-41558725 TTTCCTTGTAGAAGTCTTTCAGG - Intergenic
932289804 2:70567215-70567237 TTTCCTTTCTGCATTCCTGCTGG - Intergenic
933227060 2:79762359-79762381 TTTTCTTGAAGCACTCCTCCAGG - Intronic
935264390 2:101382108-101382130 TATCCTGAAAGCAGTCGTGCTGG - Intronic
940345324 2:152622754-152622776 TGTCCTTGAAGCAGACATCCTGG + Intronic
940554243 2:155203081-155203103 TTTCTTTAAAGCAGTCCCTCTGG - Intergenic
948510262 2:238459185-238459207 TGTGCTTGAAGCAGTGTTGCAGG + Intergenic
1169096405 20:2903102-2903124 TTTCCTTTGAGCAGTCATGTAGG - Intronic
1172574355 20:35996044-35996066 CTTCCTTGAAGAAGTCTTCCTGG + Intronic
1173733159 20:45342318-45342340 TTGCCTTGGAGAAGCCCTGCCGG - Intronic
1175707967 20:61195100-61195122 TTTCCATGGTCCAGTCCTGCAGG - Intergenic
1181911965 22:26245402-26245424 TTCCCTTGAACCTGTTCTGCAGG + Intronic
1182504563 22:30772582-30772604 TGTCCTAGGAGCAGCCCTGCTGG + Intronic
1185254487 22:49824876-49824898 AGTCCTTGCAGCATTCCTGCTGG + Intronic
949522562 3:4870015-4870037 TTACTTTGAAGCTGTCCTGATGG + Intronic
950027896 3:9833267-9833289 TTTCCTAGAAGCTGACCTGTGGG - Intronic
950257667 3:11519349-11519371 TTTCCTTGACGCAGTATTTCTGG + Intronic
950857055 3:16115601-16115623 GATCCTTGCAGCAGTCCTGAGGG + Intergenic
951648398 3:24920141-24920163 TTTTCTTGAAGAGGTCCTGCTGG + Intergenic
951826192 3:26871873-26871895 TTTTGTTCAAGCACTCCTGCAGG + Intergenic
952136803 3:30431906-30431928 TCTCCTTGAAGAGGTCCTTCAGG - Intergenic
952598650 3:35050652-35050674 CTTCCTTGAGGCAGTCTCGCTGG - Intergenic
953172176 3:40517112-40517134 TTCCCTTGAATCCATCCTGCTGG - Exonic
954752909 3:52823726-52823748 CTTCCTGGTAGAAGTCCTGCAGG + Exonic
957019891 3:75113844-75113866 TATCCTTCAACCAGTCCTGTTGG - Intergenic
957834108 3:85563536-85563558 TTTCATTCAAGGAGTCATGCTGG - Intronic
958142367 3:89578316-89578338 TTTCCTGTAAGCAGTCAAGCAGG + Intergenic
958561817 3:95757759-95757781 TCTCCTTGAAGAGGTCCTTCAGG - Intergenic
958907555 3:99958709-99958731 GTTCCCTGAAGGAGCCCTGCTGG - Intronic
959511368 3:107216495-107216517 ATTCCTTCAAGTAGGCCTGCTGG - Intergenic
959942096 3:112090959-112090981 TGGCTTTGAAGCAGTTCTGCAGG + Intronic
960343776 3:116507113-116507135 TCTCCTTGAAGGGGTCCTTCAGG + Intronic
960808859 3:121609770-121609792 TATCCTTTAAGCTGTCCTTCAGG - Intronic
961643388 3:128379199-128379221 TCTCCTGGAAGCCGTCCTGACGG + Intronic
965355396 3:167667209-167667231 TTTCCTTGTAGCAGTTTTGTAGG + Intergenic
968399337 4:278548-278570 TTTCTTTGAAACAGTGCTGGGGG - Intronic
969828281 4:9775421-9775443 TTCCCTGGAAGCAGACCTCCTGG - Intronic
971359118 4:25920710-25920732 TTACCTTGAATGAATCCTGCAGG - Intronic
972130773 4:35830814-35830836 TCTCCTTGAAGAGGTCCTTCAGG + Intergenic
972231140 4:37073913-37073935 TTTCCTTGCATCACACCTGCTGG - Intergenic
974180831 4:58382516-58382538 TTTCCTTGAAGAGCTCCTTCAGG + Intergenic
975869117 4:78758643-78758665 TCTCCTTGAAGAGGTCCTTCAGG - Intergenic
976857885 4:89626752-89626774 CTTCCTTGAAGCATACCTTCAGG - Intergenic
979285736 4:118922309-118922331 TTTCCCTGAAGAAATCCTTCAGG + Intronic
979632540 4:122920237-122920259 CTACCTTGAAGAACTCCTGCTGG - Intronic
980307930 4:131088664-131088686 TTTTCTTGATGCAGTCTTACAGG + Intergenic
984234223 4:177136961-177136983 TTTGCTTCAAGAAGTACTGCAGG + Intergenic
988001892 5:25359852-25359874 TCTCCTTGAAGAGGTCCTTCAGG - Intergenic
988691091 5:33573046-33573068 TCTCCTTGAAGAGGTCCTTCAGG - Intronic
992790504 5:80209322-80209344 CTTCTTAGAAGCAGTCCTGTTGG - Intronic
993496307 5:88613399-88613421 TTTCCTTGCAGGAGTCTTCCTGG + Intergenic
999820955 5:155228054-155228076 TTTGCTATAAGCAGTCCAGCAGG - Intergenic
1002657110 5:180758374-180758396 TCTCCTTGAAGAGGTCCTTCAGG + Intergenic
1002715859 5:181226730-181226752 GCTCCTTGGAGCAGTCCTACAGG - Intronic
1009332544 6:62441583-62441605 TTTGCTTGAAGAACTACTGCAGG - Intergenic
1010234804 6:73566472-73566494 TTCCCTCCAAGCAGTCCTTCAGG - Intergenic
1013478214 6:110529311-110529333 CTTCCTTTGAGAAGTCCTGCTGG + Intergenic
1013886881 6:114978134-114978156 TTTCCTTCAAGGACTCCTCCAGG - Intergenic
1015123413 6:129725638-129725660 TTTCACTGAAACAGTCCTGCTGG + Intergenic
1019279969 7:194650-194672 TTTCCTTGAACCTGACCAGCAGG - Intronic
1021063529 7:16144080-16144102 TCTTCTTAAAGCAGTCCTCCTGG - Intronic
1023476423 7:40583918-40583940 TTTCCATGAAGCAGGCATCCTGG - Intronic
1025851637 7:65249362-65249384 TTTCCTAGAACCAGTCTTGTTGG - Intergenic
1028561931 7:92185441-92185463 TCTCCTTGAAGGGGTCCTTCAGG + Intergenic
1029507547 7:100971444-100971466 TTACCTCGAAGGTGTCCTGCAGG - Intronic
1032744562 7:134772799-134772821 TTTCCTTAAAACATTCCTCCTGG + Intronic
1032839465 7:135702778-135702800 TTTCCATGAAGAAGTGCTGAGGG + Intronic
1034610426 7:152362478-152362500 TTTCTTTGAAGCAGCCATGTTGG - Intronic
1041248516 8:55912124-55912146 TTTTCTTGCAGCAGTCTAGCTGG - Intronic
1043547843 8:81335321-81335343 TTTCCAGGAAGGAGTCCTGACGG + Intergenic
1044847942 8:96399925-96399947 TTTGCTTGAATCTGTTCTGCTGG + Intergenic
1045200084 8:99971673-99971695 TCTCCTTGAAGATGTCCTTCAGG - Intronic
1047855783 8:128910117-128910139 TCTCCTTGAAGGTGTCCTACAGG - Intergenic
1048495402 8:134931319-134931341 TTTCCTTCAAGCTGTCTTCCAGG + Intergenic
1048938441 8:139376228-139376250 TTGGCCTGAAGCAGTGCTGCAGG + Intergenic
1048995871 8:139793420-139793442 TTTCCTTGAAGAAATGCTGCTGG - Intronic
1049656675 8:143802167-143802189 TGTCCTTGAGGGAGTCCTGGTGG - Intronic
1051223203 9:14872362-14872384 TCTCCTTGAAGAGGTCCTTCAGG + Intronic
1051834151 9:21316240-21316262 TTACCTTATATCAGTCCTGCTGG + Intergenic
1052143111 9:25012628-25012650 TTCTTTTGAAGCAGTTCTGCTGG - Intergenic
1055107152 9:72525036-72525058 TGTCCTTGAAGCCGGCCTTCTGG - Intronic
1057106792 9:92427008-92427030 TTTCCTTGCTCCAGTCCTCCTGG - Intronic
1057607421 9:96509687-96509709 TTTCCTTGAAGCAGATCTGGTGG + Exonic
1057741299 9:97714368-97714390 TATCCTTACAGCAGTCCTGGAGG + Intergenic
1061752843 9:132792710-132792732 CTTTCTGGATGCAGTCCTGCTGG + Exonic
1186891528 X:13963643-13963665 TTTCAATGAACCAGTCCTGTTGG - Intergenic
1187720126 X:22141193-22141215 TGTACTTTAATCAGTCCTGCTGG + Intronic
1188435403 X:30152840-30152862 TTCCCTTGAAGAGGTCCTGCAGG - Intergenic
1189173257 X:38929926-38929948 CATCCTGGCAGCAGTCCTGCAGG - Intergenic
1190877735 X:54471472-54471494 TTTCCCTGGTGCAGCCCTGCAGG + Exonic
1191828996 X:65394897-65394919 TCTCCTTGAAGAGGTCCTTCAGG + Intronic
1192300981 X:69902454-69902476 CTTCCCTGATGCATTCCTGCTGG + Intronic
1195731152 X:107968800-107968822 TTTCCTTGCCGCAGTACTGTGGG + Intergenic
1195820103 X:108935399-108935421 TCTCCTTGAAGAGGTCCTTCAGG + Intergenic
1200382477 X:155853339-155853361 TCTCCTTGAAGAGGTCCTTCTGG + Intergenic
1201145221 Y:11060934-11060956 TTTCCTTGATCCAGTCTTGGTGG - Intergenic
1202350238 Y:23982007-23982029 TCTCCTTGAAGAGGTCCTTCAGG + Intergenic
1202520541 Y:25688114-25688136 TCTCCTTGAAGAGGTCCTTCAGG - Intergenic