ID: 1158131967

View in Genome Browser
Species Human (GRCh38)
Location 18:54162022-54162044
Sequence CCATAGCCAAGAAGAGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 269}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158131961_1158131967 1 Left 1158131961 18:54161998-54162020 CCAGGAGCTAAGACAGCCACCAT 0: 1
1: 0
2: 1
3: 17
4: 146
Right 1158131967 18:54162022-54162044 CCATAGCCAAGAAGAGAACAGGG 0: 1
1: 0
2: 0
3: 23
4: 269
1158131959_1158131967 29 Left 1158131959 18:54161970-54161992 CCACGAGACAAGGAACTACAGGC 0: 1
1: 0
2: 0
3: 12
4: 123
Right 1158131967 18:54162022-54162044 CCATAGCCAAGAAGAGAACAGGG 0: 1
1: 0
2: 0
3: 23
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158131967 Original CRISPR CCATAGCCAAGAAGAGAACA GGG Intronic
900653266 1:3741811-3741833 CCACAGCCAGGATGAGGACATGG + Intergenic
901159156 1:7161896-7161918 CAATAGCAATGAAGAAAACAGGG + Intronic
901804809 1:11731785-11731807 CCATAGCCAAGAATAGGTCGTGG + Intergenic
901941065 1:12662084-12662106 ACATAGCCAAGAAGATATTATGG + Intronic
902994293 1:20211735-20211757 CCCTAGGCTAGAAGAGAAAAGGG + Intergenic
903439128 1:23374328-23374350 CCAAAGCCAAGCAGAGGGCAAGG + Intergenic
903543964 1:24112089-24112111 CCGAGGGCAAGAAGAGAACAAGG - Exonic
906258564 1:44368837-44368859 CCAAGGCCAGGAAAAGAACAAGG + Intergenic
907307562 1:53521792-53521814 CCAGAGCCAGGATGGGAACAGGG + Intronic
909551423 1:76901573-76901595 AAATAGCAAAGAAGAGAACAGGG + Intronic
911249565 1:95559496-95559518 CAATAGCCAGGAAGATAACGGGG - Intergenic
912925781 1:113911804-113911826 CTATAGCAAAGAATGGAACAAGG + Exonic
913057401 1:115175203-115175225 CCATACCCAAGAACAAAACCTGG - Intergenic
913202819 1:116509674-116509696 CCATAGAGAAGAATAAAACAGGG - Intergenic
913591916 1:120337485-120337507 CCAAAGCCAAGGAGAGAGCAAGG - Intergenic
913651440 1:120917661-120917683 CCAAAGCCAAGGAGAGAGCAAGG + Intergenic
914169669 1:145211410-145211432 CCAAAGCCAAGGAGAGAGCAAGG - Intergenic
914524783 1:148455372-148455394 CCAAAGCCAAGGAGAGAGCAAGG - Intergenic
914598892 1:149180461-149180483 CCAAAGCCAAGGAGAGAGCAAGG + Intergenic
914641618 1:149611762-149611784 CCAAAGCCAAGGAGAGAGCAAGG + Intergenic
915784658 1:158596898-158596920 CTGGAGCCAAGAAGTGAACAAGG + Intergenic
916648789 1:166816298-166816320 CCTCAGCCAAGAAGAGACCCTGG + Intergenic
917200215 1:172506895-172506917 CCATTGCCAAGATGACAGCATGG + Intergenic
917307445 1:173640971-173640993 CCATACCATAGAAGTGAACAAGG - Intronic
917692356 1:177482459-177482481 CCATAGCTAAGGACAGAGCAAGG - Intergenic
918995735 1:191757025-191757047 CCATCTCCAGGAAAAGAACAAGG + Intergenic
919806081 1:201381768-201381790 CCACAGGCAAAAAGGGAACAGGG + Exonic
921308915 1:213823958-213823980 ACACAGCCAGTAAGAGAACAGGG + Intergenic
922158577 1:223060487-223060509 CCCCAGCCAAGGACAGAACAGGG + Intergenic
923885726 1:238153029-238153051 CAATAGCCAAGAAGACAAAGAGG - Intergenic
1063051979 10:2460521-2460543 CCATAACCAAGAATGGAAAAGGG - Intergenic
1065116276 10:22486252-22486274 CCATGGCCATTAAGACAACAGGG - Intergenic
1065786010 10:29215717-29215739 CCATGGCCAAGAAGACACCATGG - Intergenic
1066129621 10:32380005-32380027 AACAAGCCAAGAAGAGAACAGGG + Intergenic
1067074770 10:43170973-43170995 TCATAGCCAAGAGGAGACTAAGG + Intronic
1070606955 10:77905387-77905409 CTATGGCCAAGATGAGAATATGG + Intronic
1071354975 10:84784827-84784849 CCTGGGCCAAGGAGAGAACAGGG - Intergenic
1071366815 10:84908344-84908366 CCAAAGCCAAGGAGAGAAAGAGG + Intergenic
1072729256 10:97834132-97834154 CCATAGCCAAGAAGGGTAGAGGG - Intergenic
1073033198 10:100544601-100544623 CCGTAGTCAAGAAGAGTACACGG + Intronic
1073160214 10:101387481-101387503 AAATAGCCAAGAAGAAAATAAGG - Intronic
1073361940 10:102906621-102906643 CAGTAGCCAAGAAGGGCACATGG + Intergenic
1074015227 10:109527893-109527915 CCATAGCCAAAATGGAAACATGG + Intergenic
1074516761 10:114177572-114177594 CCATGGCCAAGAAGAGCCTAAGG + Intergenic
1074538551 10:114346082-114346104 CCACAGCCTAGAAGAGAAGGAGG - Intronic
1076432911 10:130419614-130419636 CCACTGCCAAGAAGAGCACCTGG - Intergenic
1077609276 11:3634510-3634532 CCAGGGCCAAGAAGGGAAAAAGG + Intergenic
1078458166 11:11491871-11491893 CCACAGCCAAGCAGAGCCCAAGG + Intronic
1078615492 11:12861573-12861595 CCAAAGACTAGAAGAGAACTGGG + Intronic
1078758647 11:14234293-14234315 CCAGAGCAAAGAAGGGAAAAGGG - Intronic
1079811705 11:25005186-25005208 CCCCAGCCCAGAAGGGAACAAGG - Intronic
1080311141 11:30893996-30894018 CCTTAGCAAAGAAGAGAAAAAGG - Intronic
1082165526 11:48945851-48945873 CTATATGCAAGAAGACAACACGG + Intergenic
1083167609 11:60900768-60900790 CCATGCCCATGAAGAGGACAAGG + Intronic
1083536683 11:63474893-63474915 CCATGGTCAAAAAAAGAACAAGG - Intronic
1085785457 11:79444478-79444500 CCATCACCCAGAAGAAAACACGG - Intergenic
1088121337 11:106374228-106374250 CAATAGGCAAGAAGACAGCATGG + Intergenic
1088343881 11:108800483-108800505 TCATAGCCAAATGGAGAACAAGG - Intronic
1089078688 11:115759457-115759479 CCATAGCCAAGGGGAGAAGCTGG + Intergenic
1089288443 11:117422596-117422618 TCATTGCCCAGAAGAGGACATGG + Intergenic
1090865336 11:130695503-130695525 TCAATGCCCAGAAGAGAACAAGG + Intronic
1093187754 12:16041219-16041241 TCATAGCCAAGAACAGGAGAGGG + Intergenic
1094454591 12:30618547-30618569 GCATAGTGAAGAAGAGAGCAAGG - Intergenic
1097707751 12:62885278-62885300 CAATAGCCAACAAGAAAACAGGG - Intronic
1097744694 12:63288160-63288182 CCAAAGCCAAGACGACACCACGG - Intergenic
1098190157 12:67939395-67939417 CAAATGCCAAGAAAAGAACAAGG + Intergenic
1100200107 12:92288921-92288943 CCTTTGCCAAGAAGAGCAGAGGG - Intergenic
1100281715 12:93124748-93124770 CCATATCCCAGAAAAGAAAATGG + Intergenic
1102682995 12:114703127-114703149 ACTTGGCCAAGAAGAGAAAATGG + Intergenic
1103185796 12:118956095-118956117 CCACAACCAAGAAGAGACAAGGG - Intergenic
1103569363 12:121834331-121834353 CCAGAGCCTAGAAGAGTACCTGG - Intergenic
1104028713 12:125048873-125048895 CCATAGCCAAGTAGAGGTGATGG + Intergenic
1104160437 12:126174534-126174556 TCATAGCCAAGAGAAGTACATGG - Intergenic
1107122621 13:36812016-36812038 CCCTAGCACAGAAAAGAACAGGG + Intergenic
1107148529 13:37085772-37085794 CTCTAGCCAAGAAGAGTAAAGGG - Intergenic
1108091562 13:46855069-46855091 CCAGAGCTAAGAAGAGGCCATGG + Intronic
1108126065 13:47244225-47244247 ACATACACAAGAGGAGAACAGGG - Intergenic
1109571660 13:64200077-64200099 ATATAGCCATGGAGAGAACATGG + Intergenic
1111257727 13:85694490-85694512 GCATAACAAAAAAGAGAACATGG - Intergenic
1111624235 13:90763389-90763411 TCATAGCTAAAAGGAGAACATGG + Intergenic
1111779413 13:92702632-92702654 CAATAACCCAGAAGAGAAAATGG - Intronic
1112165059 13:96909438-96909460 CCATAGCCAGGAGGATCACAAGG - Intergenic
1113109262 13:106804753-106804775 TCACAGCCAAGAAGAGTCCACGG - Intergenic
1113480717 13:110618496-110618518 TCATAGCTAGGAAGAAAACACGG - Intronic
1113821725 13:113219239-113219261 CCATACCCAATAAATGAACACGG - Intronic
1114979924 14:28150040-28150062 CCATTGCCCAGAAGTGAATAAGG + Intergenic
1116440386 14:44944649-44944671 AGATAGCAAAGAAGAGAACTAGG - Intronic
1117823689 14:59678093-59678115 GAATTGCCAAGAAGGGAACAAGG + Intronic
1118643434 14:67815429-67815451 TCATAAGCAAGAAGAGAGCAGGG + Intronic
1119643058 14:76329202-76329224 CCAGGGCCCAGGAGAGAACAAGG + Intronic
1119889955 14:78175067-78175089 CCAGAGCCCAGGAGAAAACAGGG - Intergenic
1119912777 14:78365795-78365817 CCAGAGCCAAGAAGAGTGCCTGG - Intronic
1120413120 14:84183693-84183715 TCACAGCCAAGAAGAGCATAAGG - Intergenic
1120440289 14:84528336-84528358 CAATATCCAAAATGAGAACAAGG + Intergenic
1120493953 14:85210735-85210757 TCAGAACCAAGAAGAGAACCTGG + Intergenic
1121055467 14:90848307-90848329 CTATAGCAACGAAGGGAACATGG + Exonic
1121852656 14:97236313-97236335 CCACAGCCAGGGAGAGAAAAAGG - Intergenic
1122731855 14:103806132-103806154 CCATAGCTAAGGATAGAACTTGG - Intronic
1122908882 14:104816588-104816610 CCGTAACCAAGAAGCGAGCAAGG - Intergenic
1123477779 15:20603001-20603023 CCAAAGCCAAGAATTGAACCTGG - Intergenic
1123640236 15:22397381-22397403 CCAAAGCCAAGAATTGAACCTGG + Intergenic
1127765679 15:62183842-62183864 CCATATCCAAAGACAGAACAAGG - Intergenic
1128858356 15:71040962-71040984 CAACAGCCAACAAGAAAACAGGG + Intronic
1129669135 15:77597466-77597488 AGCAAGCCAAGAAGAGAACAGGG - Intergenic
1131379907 15:91954940-91954962 CCAAGGCCAAGAGGAGAACATGG - Intronic
1131599091 15:93828883-93828905 CCAGAGCCAGGAAGTGGACATGG + Intergenic
1135564146 16:23498994-23499016 GCAGAGGCAGGAAGAGAACAGGG + Intronic
1138681315 16:58685255-58685277 ACACAGCCAAGAACAGAACCAGG - Intergenic
1139029118 16:62857897-62857919 CCAGAGCCAAGAAAAGGACCAGG + Intergenic
1139582216 16:67880399-67880421 CCACAGCCAAGAAGAGGAGGTGG - Intronic
1139811847 16:69625872-69625894 ATAAAGCCAAGAAGAAAACAGGG + Intronic
1140381043 16:74488159-74488181 CAATCACCAAGCAGAGAACAGGG + Intronic
1140560745 16:75978034-75978056 CCATGATCAAGAAGAGAAAAAGG - Intergenic
1142405620 16:89887553-89887575 TAATAGTCAAGGAGAGAACACGG - Intronic
1144271831 17:13625102-13625124 TCATACCCAAGAAGAGAAAATGG + Intergenic
1146505847 17:33404672-33404694 CCACAGCCCAGAAGAGTGCATGG - Intronic
1147383758 17:40070368-40070390 CCATACCTGAGAATAGAACAGGG + Intronic
1147623362 17:41883116-41883138 CCATACCTCAGAGGAGAACATGG + Exonic
1148677595 17:49454147-49454169 CCAGAGCCAAGGAGACACCAAGG - Intronic
1149116653 17:53105456-53105478 CCATATCCAAGAAGAAACCAGGG - Intergenic
1149938430 17:60834713-60834735 CCATAGCTAACAAAAAAACATGG - Intronic
1150453732 17:65290539-65290561 GCATTGCCAAGAAGAAAACTAGG + Intergenic
1150985085 17:70186830-70186852 TCAAAGCCAGGAAGAGGACACGG - Intergenic
1153766032 18:8376006-8376028 CCAGAACAAGGAAGAGAACAAGG - Intronic
1156171867 18:34494517-34494539 CCAAAGCCAAAGAGAGAAGAGGG + Intronic
1156494349 18:37516220-37516242 CCAGGGCCAAGAAGGGAGCAGGG - Intronic
1158131967 18:54162022-54162044 CCATAGCCAAGAAGAGAACAGGG + Intronic
1158196203 18:54887495-54887517 CCTTAACCAAGAATAGCACATGG + Intronic
1160939930 19:1615504-1615526 CCATAGCCCAGACGAGGACGAGG - Exonic
1161633809 19:5374372-5374394 CCAAAGCCTAGAACAGAACTTGG + Intergenic
1165731366 19:38147874-38147896 ACAGAGCCAAGATGAGAACCCGG + Intronic
1166834358 19:45658167-45658189 TTATATCCCAGAAGAGAACAGGG - Intergenic
1167848561 19:52184436-52184458 CCATTGGCAGGAGGAGAACAGGG - Intergenic
1168578874 19:57536689-57536711 CCATAACCAGCAAGAGAACAAGG - Intronic
1168585589 19:57588887-57588909 ACCCAGCCAAGAAGAGAGCAAGG - Intronic
926196073 2:10764415-10764437 CAATAGCCAAGGTGAGAAAAGGG + Exonic
926982157 2:18584288-18584310 ACATAGCCACGAAGAGGACAGGG + Intronic
928537764 2:32257145-32257167 TCAGAGCCAAGAAGGCAACATGG + Intronic
929069733 2:38017920-38017942 CCCTTGCCAGGCAGAGAACAAGG - Intronic
932312301 2:70753511-70753533 CCAGAGCCCAGAAGAAAAGATGG + Intronic
934084059 2:88494666-88494688 CCAAAGCCAGGAAGGCAACATGG + Intergenic
936334375 2:111576190-111576212 CAATATCCAAGGAGAGAGCAAGG - Intergenic
936608831 2:113981891-113981913 CAATAGCCCAGAAGAGAGAAAGG + Intergenic
936842993 2:116796321-116796343 ACACAGCCAAGAAGGGAAGAAGG - Intergenic
937443446 2:121936455-121936477 CCAGAGCCTAGAACAGAACCTGG - Intergenic
938667911 2:133558282-133558304 CCAGAGCAAAGAAGGGACCATGG - Intronic
939338875 2:140867669-140867691 CCAAAGCCAATAAGTGGACAGGG - Exonic
939681190 2:145135460-145135482 ACATAGCAAAGATGAGATCAAGG + Intergenic
939985842 2:148829077-148829099 CCACAGCCAAGAAGAGTCTAAGG - Intergenic
940712555 2:157179887-157179909 CTTCAGCCAAGAAGACAACAGGG + Intergenic
941635577 2:167931917-167931939 CCAGTCCCAAGAAGGGAACAAGG - Intergenic
941658461 2:168169929-168169951 CCCTAGCCAAGAAGTGAAGAGGG - Intronic
946345297 2:219104920-219104942 CTAAAGCCATGAAGAGACCATGG + Intronic
946481762 2:220063774-220063796 CCAAAGTAAAGAGGAGAACAAGG + Intergenic
1168811223 20:706033-706055 TCATAGCTGAGAAGAAAACAAGG + Intergenic
1169797514 20:9480272-9480294 CCAAAGCCAAGAGGAGCGCATGG + Exonic
1170490319 20:16865827-16865849 TTGTAGCCAAGAAGACAACATGG + Intergenic
1170677180 20:18493304-18493326 CCATTGCCTAGAAGAGAGCCTGG - Intronic
1171366400 20:24627766-24627788 CCACTGCCAAGTGGAGAACAAGG + Intronic
1172202214 20:33134423-33134445 CATTAGCCCCGAAGAGAACAGGG + Intergenic
1175122533 20:56727200-56727222 CCGCAGCCAAGAAGAGCATAAGG - Intergenic
1175217735 20:57400384-57400406 CCACAGCCCAGGAGAGGACAGGG - Intronic
1175515135 20:59564541-59564563 CCACAGCCACGGAGAGAAAAGGG + Intergenic
1176933103 21:14837159-14837181 CCATTGCCAAGTAGAGTTCATGG - Intergenic
1177197005 21:17914012-17914034 CCTGAGCCAAGACCAGAACAGGG + Intronic
1179317908 21:40261485-40261507 CCAAAGACAAGAAAAGACCAAGG - Intronic
1181442492 22:22943919-22943941 CCAGATCCAAGAAGAGAGGAGGG + Intergenic
1181540247 22:23569129-23569151 CCATAGCCAGGAGGGGAAGAGGG + Intergenic
1183000170 22:34850436-34850458 CCAAAACCAAGAAGGCAACAAGG + Intergenic
1185185892 22:49400104-49400126 CGATATCCAAGCAGAGAAGAAGG + Intergenic
952256503 3:31699962-31699984 CAACTGCCAAGAAGAGAAAAGGG + Intronic
954038895 3:47869378-47869400 CAAAAGCCAAGAAGGGAAGAAGG + Intronic
954163864 3:48740544-48740566 CCATGGCCAAGAAGGCTACAGGG + Intergenic
954450099 3:50567146-50567168 GCAAAGCCAAGAAAAGAACCCGG - Intronic
955774577 3:62419678-62419700 CCATACCTAAGAAGCGATCAGGG - Intronic
962216867 3:133530153-133530175 CCATAGCCCACTAGGGAACATGG - Intergenic
962395188 3:135009257-135009279 CCAGAGCCATGAGGAGGACAGGG + Intronic
963754184 3:149216366-149216388 CCATAGCCAGCAAGCAAACAAGG - Intronic
966679931 3:182631206-182631228 CCAAAGCCAGGAAAAAAACAGGG + Intergenic
967077247 3:186014637-186014659 CCATAACCAAGAAGAGCTTAAGG - Intergenic
969301371 4:6299278-6299300 CCACAGCCAAGAGGAGCAGAGGG - Intronic
971932799 4:33106902-33106924 CCATAGCCTGGAAGAGAAACAGG - Intergenic
974086438 4:57265810-57265832 ACCTAGCCAAGAACAGGACAAGG - Intergenic
974116189 4:57581991-57582013 TTATAGTCAAGAAGAGAAAAAGG - Intergenic
975045864 4:69803239-69803261 CCATTGCCCAGTAGAGTACAGGG + Intergenic
975398653 4:73907687-73907709 CCAGAGCCAAGAAGAAGGCAAGG + Intergenic
975524879 4:75338049-75338071 CCATTTCCAAGATGAGAAAACGG + Intergenic
977173858 4:93796040-93796062 CAATAGCCAGTAAGAGAATAGGG - Intergenic
977412745 4:96689133-96689155 CCATATCCCAGAGGAAAACATGG + Intergenic
980027386 4:127782478-127782500 CAATAGCCCAGAAGAGGACACGG + Exonic
981250197 4:142591887-142591909 TCATAGCCAAGAAGAAACTAGGG + Intronic
981370023 4:143949443-143949465 CTGCAGCCAAGAAGAGAACTGGG + Intergenic
981379786 4:144059490-144059512 CTGCAGCCAAGAAGAGAACTGGG + Intergenic
982323739 4:154108145-154108167 CCAGAACCTAGAAGAGAGCATGG + Intergenic
983481632 4:168281280-168281302 TCATAAACAAGTAGAGAACAGGG - Intronic
983749537 4:171248741-171248763 CCATAGTCAACAAAACAACATGG - Intergenic
985115991 4:186591529-186591551 GCATATCCAAGAAGTGCACATGG - Intronic
988688821 5:33551100-33551122 CCATAGCCAGAAAGACAGCATGG - Intronic
990172929 5:53075221-53075243 TGAAAGCCAAGAAGAAAACAAGG + Exonic
990208945 5:53460729-53460751 CCATAGCCAAGAGGAGCCTAAGG + Intergenic
990236826 5:53777915-53777937 GCACAGGGAAGAAGAGAACATGG + Intergenic
990846258 5:60143115-60143137 CCATAGAGTAGAAGAGAAAAGGG - Intronic
992407289 5:76471976-76471998 TCAGAGCCAGGGAGAGAACAAGG - Intronic
995767070 5:115630116-115630138 CCATAGTCAAGAAGGAAAGACGG + Intronic
997429911 5:133830434-133830456 CCATTGCCAACAAGGGCACAGGG + Intergenic
998610175 5:143680249-143680271 AAATAGCCAAGAAGGGAAAAGGG - Intergenic
999354514 5:150912482-150912504 CCATAACCAAGAAGATCAGATGG + Intergenic
999472845 5:151871252-151871274 CCAGACCCAAGAAGATAAGAAGG + Intronic
999889671 5:155963731-155963753 CAATAGCAAAGAGGAGAATAAGG - Intronic
1000447492 5:161341165-161341187 CCAAAGAAAAGAAGAAAACAAGG - Intronic
1001886302 5:175293490-175293512 TCATAGCCATGCAGAGCACAAGG - Intergenic
1004475669 6:15968902-15968924 CCATAGCCATGAAGAGCCTAAGG + Intergenic
1004989798 6:21124633-21124655 CCATTGCCACAAAGAGAACGAGG - Intronic
1005432885 6:25776930-25776952 CAATATCCAAGAAGTTAACAAGG - Exonic
1005900375 6:30212269-30212291 CCACAGCCAAGAGGAGCATAAGG + Intronic
1006201294 6:32293922-32293944 GAATAGCCGAGAAGAAAACAAGG - Exonic
1008908675 6:56708962-56708984 ACATATCCAAAAAGAGAAAAAGG - Intronic
1009757789 6:67962445-67962467 CCAAAGCCTAGAATAGGACAAGG + Intergenic
1010941556 6:81924769-81924791 CCATAGACAACAAGAAGACAAGG + Intergenic
1012695365 6:102375062-102375084 CCAAAGCCAAATACAGAACAAGG + Intergenic
1013847119 6:114466652-114466674 CCATGACCAAGCAGAAAACATGG - Intergenic
1014036304 6:116770155-116770177 CAATTGCCAAGGAGAAAACAAGG - Intergenic
1015849314 6:137555199-137555221 CCATAGTCACCAAAAGAACATGG - Intergenic
1018462667 6:164013774-164013796 ACATTTCCAAGAACAGAACATGG - Intergenic
1019457338 7:1137285-1137307 CCATGGAGAAGATGAGAACAGGG - Intronic
1020346088 7:7165140-7165162 CAGTAGCCAGGAAGAGAAGATGG + Intronic
1020714927 7:11661015-11661037 CTATGGCCAAGAAGTGAAGAAGG + Intronic
1021580099 7:22143300-22143322 TCTTAGGCAAGAAGAGACCATGG - Intronic
1022016282 7:26351530-26351552 TCATAGCCAAGAGGAGCCCAAGG + Intronic
1022556100 7:31298210-31298232 CAATAGCCAGGAAGAAAATAAGG - Intergenic
1023796751 7:43799860-43799882 CCAAAGGCAAGATGAGATCAGGG - Intronic
1024412639 7:49063723-49063745 CAATACCCAAGAGGAGAATATGG - Intergenic
1024501525 7:50113468-50113490 CCACAACCATGATGAGAACAAGG + Intronic
1028939807 7:96508684-96508706 CTGTAGCCAAAAAGTGAACATGG - Intronic
1030186709 7:106769622-106769644 CCGTAGCCAAGAAAAGATCTGGG + Intergenic
1031085873 7:117301104-117301126 CCACAACCAAGAAGTGACCATGG - Intronic
1031600046 7:123696637-123696659 CCATACCAAAGAAAAGAAGAAGG - Exonic
1032411223 7:131694376-131694398 CCAGAGCCTAGAAGAGCACATGG - Intergenic
1032480140 7:132239507-132239529 CCTCAGCCAAGCAGAAAACAGGG + Intronic
1033292755 7:140101685-140101707 CCAGAGCCTAGAAGAGGAAATGG + Intronic
1037479916 8:19294937-19294959 CCCTGGCCAGGAAGAGTACAGGG + Intergenic
1037903024 8:22698982-22699004 CCATCGCCCAGAGGAGAATAAGG + Intergenic
1037974463 8:23199911-23199933 CCACAACCTAGAAGAGAAGACGG + Exonic
1038557500 8:28535507-28535529 TCATAGCCAAGAGGAGGCCAAGG - Intronic
1039031802 8:33317438-33317460 CCATAGCCAATCAGAAATCAGGG + Intergenic
1039288305 8:36066749-36066771 CCATTGCCAAGAAGAGGTCTGGG + Intergenic
1039767316 8:40643050-40643072 TCATAGCTCAGAATAGAACATGG - Intronic
1040888510 8:52290870-52290892 CCTAAGGCGAGAAGAGAACAAGG - Intronic
1045007481 8:97928885-97928907 CCATTGCATAGATGAGAACATGG - Intronic
1045260912 8:100573228-100573250 CAATGGTCAAGCAGAGAACAGGG + Exonic
1045307948 8:100974928-100974950 CCCTAGCCAATGACAGAACAGGG - Intergenic
1047217382 8:122887660-122887682 CCAAAGCAAAGAAAAGAAAATGG + Intronic
1048632603 8:136260430-136260452 CCAGAGCCAAGAAGTGAGCTGGG + Intergenic
1049105620 8:140610651-140610673 CCACAGCCCAAAAGAGAACACGG + Intronic
1049328055 8:142034312-142034334 CCACAGCCAGGAGGAGAGCAAGG + Intergenic
1050897295 9:10899588-10899610 CCATAGCTAAAAAGGGACCAAGG - Intergenic
1051002050 9:12294382-12294404 CCATAGCCACTGGGAGAACAAGG - Intergenic
1051295009 9:15586372-15586394 CCATAACAATGGAGAGAACAGGG + Intronic
1052493835 9:29200795-29200817 TCATAGCCAAGAAGAGGCTAAGG - Intergenic
1055078914 9:72247479-72247501 CCATACCCAAGAAAAAGACAGGG - Intronic
1055928574 9:81536277-81536299 CCATCCCCAGGCAGAGAACAGGG + Intergenic
1059726612 9:117014567-117014589 CCATAGAGAAGAATAGAAGAAGG - Intronic
1059968097 9:119636287-119636309 CCATGACCAAGAAGAAACCACGG + Intergenic
1060117077 9:120950439-120950461 CCAAAGCCAAGACTAGAACTTGG + Intergenic
1061144416 9:128788808-128788830 CCCAAGCCAGGGAGAGAACAAGG - Intronic
1061195411 9:129104392-129104414 CCATAGCCAGGTAGAGGGCATGG - Intronic
1061325491 9:129861420-129861442 CAAGACCCAAGAAGAGGACATGG - Intronic
1061811404 9:133164375-133164397 CCATTTCACAGAAGAGAACACGG - Intergenic
1185982421 X:4794266-4794288 CCTCAGCCAAGAAGAGAAAGAGG - Intergenic
1186357280 X:8801110-8801132 CCAAAGCCAAGAAGGGGCCAGGG + Intronic
1187088955 X:16073619-16073641 CCAAAACCAAGATGACAACAGGG - Intergenic
1187206830 X:17189803-17189825 CCATAGCAAAGGAGGGGACAAGG - Intergenic
1188174899 X:26977206-26977228 CCATCGCCAAAAAGAGAAAGAGG - Intergenic
1188632322 X:32380158-32380180 CCACAGCCATGAAGAGGGCAAGG - Intronic
1189641985 X:43082552-43082574 TCATAGACCAGAAGAGACCAAGG + Intergenic
1189743800 X:44149262-44149284 CCATCACCATGAAAAGAACATGG + Intronic
1190953702 X:55171331-55171353 CCATGGCCACGTAGAGAAAAGGG + Intronic
1191690846 X:63936284-63936306 CTATAGCCAAGTGGAGAACTGGG - Intergenic
1192168724 X:68841584-68841606 CCAAAGGTAAGGAGAGAACAGGG - Exonic
1193157325 X:78188219-78188241 CCATAGTCACGAAAACAACATGG + Intergenic
1194591844 X:95808858-95808880 CCTTAGCCAAAATTAGAACAAGG - Intergenic
1195597046 X:106704057-106704079 CCATGGCCAAGCAGAGAGGAAGG + Intronic
1196016035 X:110941509-110941531 CAACAGCCAAGAAGAAAACTAGG - Intergenic
1196900824 X:120381218-120381240 CCACAGTCATGAAGAGACCATGG + Exonic
1197291421 X:124663131-124663153 CTAGAACCAAGAAGAGAAGATGG + Intronic
1197926361 X:131650703-131650725 CCATATTCAAGATGAGAAGATGG - Intergenic
1198127722 X:133662746-133662768 CCATTGCCAAAGAGAGAAAAAGG + Intronic
1198177928 X:134173556-134173578 CCAAAGCCCAGAAGAGGACAAGG + Intergenic
1199585796 X:149414606-149414628 CCATAGGCAAGAAGAGAAATGGG - Intergenic
1199662409 X:150065331-150065353 CCATATCAAAAAAGAGAAAACGG - Intergenic
1202241148 Y:22770957-22770979 CCACAGACAAGAGGAGAGCAGGG - Intergenic
1202394134 Y:24404700-24404722 CCACAGACAAGAGGAGAGCAGGG - Intergenic
1202476651 Y:25265392-25265414 CCACAGACAAGAGGAGAGCAGGG + Intergenic