ID: 1158135123

View in Genome Browser
Species Human (GRCh38)
Location 18:54199544-54199566
Sequence TTGGACTTCCAAAATGATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 221}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158135123 Original CRISPR TTGGACTTCCAAAATGATCT TGG (reversed) Intronic
903906259 1:26689282-26689304 TTGGACTTCCAACTTTATCTGGG + Intergenic
905983870 1:42258231-42258253 TTGGATTGCCAAAATAAACTGGG - Intronic
906178251 1:43795182-43795204 TTGGAGTTATAAAAAGATCTTGG + Intronic
906797012 1:48705705-48705727 TTAAACTTCCAAAATGTTTTAGG + Intronic
908458880 1:64330161-64330183 TTGGACTTCTAAGATGATGCTGG + Intergenic
908612103 1:65873707-65873729 TTGGTCTTAGACAATGATCTTGG - Intronic
909299041 1:73987641-73987663 TTGGACTTCCAAAATTCTATAGG - Intergenic
909398356 1:75195783-75195805 TGAGACTTCCAAAATGATGGAGG - Intergenic
909412767 1:75374072-75374094 TTGCTGTTCCAAAATGTTCTAGG - Intronic
909796177 1:79738931-79738953 TTTGACTTTTAAAATGAACTGGG - Intergenic
911336580 1:96588461-96588483 TTGGACTTCCAACAACATTTTGG + Intergenic
912297515 1:108484618-108484640 TTCCACTTCCAAAAGGATCTTGG + Intergenic
914435228 1:147653656-147653678 TTGGACATCCAAAGTTATATAGG - Intronic
917724738 1:177817698-177817720 TTGCATTTCCAGAATGATGTGGG - Intergenic
919101367 1:193100946-193100968 TTTAATTACCAAAATGATCTAGG + Intronic
921866010 1:220088535-220088557 TTGGCCTCCCAAAAAGTTCTAGG - Intronic
921939497 1:220825288-220825310 TTGGCCTCCCAAAATGCTGTGGG + Intergenic
1062780539 10:201629-201651 TGGAACTTTCAGAATGATCTCGG + Intronic
1063159820 10:3410974-3410996 TTAGACTTCCATCTTGATCTTGG + Intergenic
1063701519 10:8389142-8389164 CTGAACTTCCAACATGACCTGGG + Intergenic
1065198774 10:23293640-23293662 TTGAAATTCCAGAATGATCATGG - Intronic
1066016048 10:31244961-31244983 TTGGACCTCAAAAATGTCCTTGG + Intergenic
1066359118 10:34713505-34713527 TTGGCCTCCCAAAGTGTTCTGGG - Intronic
1066476970 10:35757089-35757111 TGGGACCTCCAAAATGTCCTGGG - Intergenic
1067320337 10:45213635-45213657 TAAGACTTCCAATATGATTTTGG - Intergenic
1069781047 10:70955698-70955720 TTGCAGCTTCAAAATGATCTTGG - Intergenic
1069940483 10:71951980-71952002 TTGGACTTCAAGAATGAGTTTGG + Intergenic
1070392924 10:75986917-75986939 ATGCACCTCCAAAATCATCTTGG - Intronic
1070949026 10:80416038-80416060 ATGCACTTCCAAAATGTTCCTGG - Intronic
1074406460 10:113183888-113183910 TTGTCCTTCCACAATGATCCAGG - Intergenic
1077634073 11:3829995-3830017 TTGGCCTTCCAAAAAGTGCTGGG + Intronic
1079040170 11:17052290-17052312 TTGGATGTCCACAATCATCTTGG - Intergenic
1079958631 11:26894963-26894985 TTGAACTTCCATGATGATTTAGG + Intergenic
1080734851 11:35003616-35003638 TTAAACTTGCAAAATAATCTGGG - Intronic
1085592119 11:77773392-77773414 TTCCACTTCCAAACTGATTTCGG + Intronic
1086441422 11:86833202-86833224 TTGGATGTCCACAATCATCTTGG + Intronic
1086962109 11:92988618-92988640 TAGGACTTCCAGTATTATCTTGG - Intergenic
1087502445 11:98975045-98975067 TTGGAATTTTCAAATGATCTTGG + Intergenic
1088090412 11:106032161-106032183 TTGGACCAACAAAATAATCTAGG - Intergenic
1088336392 11:108709106-108709128 TAGGACTTCTAGAATGATGTTGG + Intronic
1088610288 11:111570040-111570062 TGGGACTTTCAAAAAGCTCTTGG - Intergenic
1088936226 11:114402868-114402890 TTGAATTTCCAACATGATGTTGG - Exonic
1091160551 11:133415718-133415740 TGGGACTACCTAAATGATCTAGG - Intronic
1091341137 11:134814863-134814885 TTGGACTTCCATGTTGCTCTGGG + Intergenic
1093095169 12:14963692-14963714 CTGGCCTCCCAAAATGATGTGGG + Intergenic
1093766210 12:22966086-22966108 TGGTAGCTCCAAAATGATCTCGG + Intergenic
1095158018 12:38882163-38882185 TTGGCCTTCCAAGATAATCCAGG - Intronic
1095817376 12:46439590-46439612 TTGTTCTTCCAAAATTATCATGG - Intergenic
1096355342 12:50936609-50936631 TTGGACTCAGAAGATGATCTTGG - Intergenic
1097732308 12:63142501-63142523 TTAGACAACCAAAATGATCGAGG - Intergenic
1097813213 12:64041636-64041658 TTGGCCTCCCAAAATGTGCTGGG + Intronic
1098119845 12:67224511-67224533 TTGGACTTATAAAATGATATAGG - Intergenic
1098280619 12:68859007-68859029 TTGGACTTCCACAATTACATTGG + Exonic
1100045954 12:90380855-90380877 TTTAACTTCCAAACTGCTCTTGG - Intergenic
1100684999 12:96978068-96978090 TTTGACTTTCAATATGATTTTGG + Intergenic
1100883113 12:99040115-99040137 TTGGGCTTCCATAATGAAGTAGG + Intronic
1106167278 13:27259431-27259453 TTGGACATCCAAAATACTCCTGG - Intergenic
1107022552 13:35766330-35766352 CTGGACTTTCAAAATCCTCTTGG - Intergenic
1107256100 13:38428326-38428348 TTGGCCTTACAAACAGATCTTGG - Intergenic
1107750194 13:43557211-43557233 TTTGACTCCCCAAATGGTCTTGG - Intronic
1108847704 13:54696518-54696540 TTTGACTTCCAGAATCACCTAGG + Intergenic
1110002509 13:70222204-70222226 TTAGACTACCAAAATTATCTGGG - Intergenic
1110214891 13:73014314-73014336 CTGGCCTTGCAAAATGAGCTGGG - Intronic
1110917745 13:81044516-81044538 TTGGATTTCCAGAATGCTTTCGG - Intergenic
1111098464 13:83546668-83546690 TGGCATATCCAAAATGATCTTGG + Intergenic
1111713389 13:91846534-91846556 TTGCACTTCACAAAGGATCTAGG - Intronic
1112086656 13:96039252-96039274 TTGGACTTCCAAAATTCTATAGG - Intronic
1114268321 14:21086123-21086145 TTGGCCTCCCAAAATGCGCTGGG - Intronic
1116227994 14:42177776-42177798 TTGAAATTCAAAAATCATCTAGG + Intergenic
1116455752 14:45119005-45119027 TTGTATTTCCAAAATTAGCTGGG - Intronic
1118803533 14:69213317-69213339 TTGGCCTCCCAAAATGTGCTGGG + Intronic
1119344710 14:73913865-73913887 TTGGCCTCCCAAAATGTTGTTGG + Intronic
1120047358 14:79822877-79822899 GTAGACTTCTAAACTGATCTTGG - Intronic
1120174441 14:81278113-81278135 TTGCACTGCCAAAGTGATCAGGG + Exonic
1125452409 15:39823281-39823303 TTGGACTCTCACAATCATCTTGG + Intronic
1126584563 15:50270836-50270858 TTGGCCTCCCAAAGTGCTCTGGG - Intergenic
1130162291 15:81413856-81413878 TTGAAATTCCAAAATGATGGTGG + Intergenic
1134283457 16:12838756-12838778 TTGGACTTCCAAAATGTCACAGG + Intergenic
1139743065 16:69052201-69052223 TTGGCCTCCCAAAATGATGTTGG + Intronic
1144122779 17:12172440-12172462 TTGGCCTCCCAAAATATTCTGGG + Intergenic
1146689527 17:34863638-34863660 AGGGCCTTCCAAGATGATCTGGG + Intergenic
1153091544 18:1351503-1351525 TTTCACTGCCAAAATTATCTGGG - Intergenic
1153256345 18:3175391-3175413 TTTGAATTTCAAAATCATCTTGG + Intronic
1153336613 18:3931865-3931887 TTTGACTTCCAAAACCACCTTGG + Intronic
1153859945 18:9192528-9192550 TTAGACTTCTAAAATGAATTGGG + Intronic
1155632783 18:27913980-27914002 TTGGCCTCCCAAAGTGCTCTTGG - Intergenic
1157401941 18:47396131-47396153 TTGGCCTCCCAAAATGTGCTGGG + Intergenic
1158135123 18:54199544-54199566 TTGGACTTCCAAAATGATCTTGG - Intronic
1159005894 18:63010978-63011000 TAGGACTTCCAATATGATGTTGG + Intergenic
1161528882 19:4774923-4774945 TTGGCCTCCCAAAGTGTTCTGGG - Intergenic
1161748436 19:6076085-6076107 TTGGCCTCCCAAAATGTGCTGGG - Intronic
1163610189 19:18296711-18296733 TTGGCCTCCCAAAGTGCTCTGGG + Intergenic
1164235327 19:23327006-23327028 TTGGAGCTCTGAAATGATCTGGG - Intronic
1164915875 19:32052059-32052081 TTGAATTTCCAAAAGGCTCTTGG - Intergenic
1167922532 19:52793620-52793642 GTGGACTTTCAAAATGCTTTTGG - Intronic
926970718 2:18464435-18464457 TTGGCCTTCAAAAATGTTCCGGG + Intergenic
930406948 2:50970456-50970478 TTGGAACTCCAAAGTAATCTAGG - Intronic
932351722 2:71037967-71037989 TTGGATGTCCACAATCATCTTGG - Intergenic
932536227 2:72599521-72599543 TAGGACATCCAATATGATGTTGG - Intronic
932601094 2:73126398-73126420 TTGGCATTACAAAATGATCCAGG - Intronic
933264080 2:80162925-80162947 TTGAATTTCCAACATGATATTGG + Intronic
933838791 2:86268120-86268142 TAGGACTTCCATTATGATATAGG - Intronic
935377978 2:102420136-102420158 TGAGACTTCCAGAATGGTCTTGG + Intronic
936162326 2:110094048-110094070 TAGGACTTCCAAAATTCACTTGG - Intronic
936182334 2:110277318-110277340 TAGGACTTCCAAAATTCACTTGG + Intergenic
937104624 2:119298532-119298554 TTGTTTTTCCAAATTGATCTTGG + Intergenic
939454263 2:142413080-142413102 TTGCACTTCTAAAATAAGCTGGG - Intergenic
939528808 2:143330804-143330826 ATGGACATCCACATTGATCTGGG - Intronic
941874006 2:170415094-170415116 TAGGACTTCCAGTATGATATTGG + Intronic
942702636 2:178730960-178730982 TTCGAGGTCCAAAATGATGTTGG - Exonic
944121696 2:196247372-196247394 TTGGAAATACAAAATGTTCTTGG + Intronic
944194561 2:197038970-197038992 TGGGACCTCCAAAATAATATGGG - Intronic
944668167 2:201973573-201973595 TCGGACTTCCCAGATGCTCTAGG - Intergenic
945169011 2:206976380-206976402 TTTAACTTCCAAAATGCCCTTGG - Intergenic
945352439 2:208797402-208797424 TTGTACTTGCAAAATGATAAAGG - Intronic
945845594 2:214940469-214940491 CTGGACTTGTAAAATGATTTAGG + Intronic
946946867 2:224830331-224830353 TTGCACTTCCAATATTGTCTTGG + Intronic
947342887 2:229158525-229158547 TTGGACTTCTGAAATGTGCTAGG - Intronic
947952704 2:234161770-234161792 TTGGAGTTCCAAAATGTGGTCGG + Intergenic
947980303 2:234403152-234403174 GGGGACTTCCAAGAAGATCTTGG - Intergenic
1168759489 20:339782-339804 TTGCACCTCTAAAGTGATCTTGG + Intergenic
1170259294 20:14385600-14385622 ATGGACTTCCAAAACAATCAAGG + Intronic
1170488483 20:16845179-16845201 TTGAATTACCAAAATGACCTCGG + Intergenic
1171295914 20:24016901-24016923 TTTCTCTTCCAAGATGATCTGGG - Intergenic
1173004655 20:39130629-39130651 TGGGCCTTCCAATATGATCTGGG + Intergenic
1173258713 20:41414173-41414195 TTAGACTTTCAAAGTAATCTGGG - Intronic
1173775868 20:45705915-45705937 CTGTACTTACAAAATGATCTAGG - Exonic
1175391413 20:58629872-58629894 TTGGAGTCCCAAAAGCATCTGGG - Intergenic
1179361643 21:40714717-40714739 TTGGACTTTCAAACTGATGCTGG + Intronic
1183247696 22:36706528-36706550 TTGGACTCCCAAAATGGGCTGGG + Intergenic
1183450078 22:37888989-37889011 TTGGCCTCCCAAAATGTGCTAGG + Exonic
1185406005 22:50651249-50651271 TTGAAGTTCCAAGATAATCTTGG - Intergenic
949765556 3:7522060-7522082 ATGAACCTCCAAAATGAGCTGGG - Intronic
951306778 3:21073614-21073636 TTTGTCTTCCAAAAGAATCTTGG - Intergenic
952305509 3:32142659-32142681 TTAGTCTTCCAGAATGAACTGGG - Intronic
952872623 3:37914795-37914817 TTAGACTTGCAAAATGAGTTGGG + Intronic
954967715 3:54625869-54625891 TAGGACCCCCAAAATGATCACGG - Intronic
955383036 3:58456582-58456604 TTGGCCTCACAAAATGAACTGGG + Intergenic
957011808 3:75014256-75014278 GTGGAATTCCAAGATGATCCTGG - Intergenic
958032333 3:88127038-88127060 TTGGTGATCCAAAATGTTCTGGG - Intronic
958183919 3:90094754-90094776 TTGAGTTTCTAAAATGATCTGGG - Intergenic
960062002 3:113332778-113332800 TAGGACTTCCAAACTTTTCTAGG - Intronic
960387564 3:117038374-117038396 TTTGACTTCCAACATGATGGTGG - Intronic
961273992 3:125712371-125712393 TTGGATGTCCACAATCATCTTGG - Intergenic
962739147 3:138349965-138349987 ATGGACTTCAGATATGATCTTGG - Intronic
963432468 3:145227109-145227131 TTTTAATTCCAAAATTATCTTGG + Intergenic
965003916 3:162991944-162991966 TATTACTTCCAAAAAGATCTTGG - Intergenic
966273415 3:178135892-178135914 CTGGAGTTCAAAATTGATCTTGG + Intergenic
967848508 3:194063840-194063862 GTGGCCTTCCCAAATAATCTGGG + Intergenic
969030318 4:4206936-4206958 TTGGGCTTCTAAAATGTTTTGGG + Intronic
969886923 4:10223198-10223220 CTGCACTTCCAAAATTGTCTTGG - Intergenic
970015800 4:11511223-11511245 TTTTACTTGCCAAATGATCTTGG - Intergenic
970165896 4:13237863-13237885 TTGGCCTCCCAAAGTGCTCTGGG - Intergenic
974466151 4:62258931-62258953 TCAGAATGCCAAAATGATCTTGG + Intergenic
974466152 4:62258939-62258961 TTGGTCTTCCAAGATCATTTTGG - Intergenic
974948470 4:68557939-68557961 TTGGGGTTCCAAAATAAACTTGG - Intronic
974957494 4:68660339-68660361 TTGGGGTTCCAAAATAAACTTGG - Intronic
975281026 4:72563005-72563027 ATGGATTTCCAAGATAATCTGGG + Intronic
975793048 4:77975835-77975857 CTGGACTTATAAAATGAGCTGGG + Intergenic
978462915 4:108977304-108977326 TTTAACTTGCAAAATGATTTTGG - Intronic
982648490 4:158054464-158054486 TTGGATTTCCAAATTTATCTTGG + Intergenic
989114576 5:37940049-37940071 TTGGATATCCACAAGGATCTTGG - Intergenic
989391260 5:40903120-40903142 TTGGCCTTCCAAAGTGCTGTGGG - Intergenic
989408869 5:41094032-41094054 TTGAACTGCCAAAATGATAATGG - Intergenic
990424325 5:55670913-55670935 AGGGATTTCCAAAATGTTCTGGG - Intronic
994244839 5:97467500-97467522 TTGGACTTCCAGAATCACCTGGG + Intergenic
994409703 5:99391250-99391272 TTGTACTTCCAAAACCATGTGGG - Intergenic
994484117 5:100374033-100374055 TTGTACTTCCAAAACCATGTGGG + Intergenic
994626592 5:102228117-102228139 TTGGACTTTGATAATGTTCTTGG + Intergenic
994774678 5:104027050-104027072 TTTGATTTCCAGAATTATCTGGG - Intergenic
997670424 5:135666807-135666829 TTGGCCCTCCAAAATGAGCAAGG - Intergenic
998281472 5:140812010-140812032 TTGGACTTTTAAAATGAGTTTGG + Intronic
1000913611 5:167052340-167052362 TTTGTCTTCCAATATGATGTTGG - Intergenic
1002538377 5:179890820-179890842 TTGGACTTCCACAGTGACCCTGG - Intronic
1003027687 6:2571452-2571474 TTAGACGCCCAAAATAATCTAGG + Intergenic
1003566316 6:7225595-7225617 TTTGACATCCTAAATGTTCTGGG - Intronic
1005790173 6:29291692-29291714 TTTGACTTTCAAAAAGATGTTGG + Intergenic
1006237133 6:32643358-32643380 CTGGACATGAAAAATGATCTGGG - Exonic
1006247111 6:32746990-32747012 CTGGACTTGAAATATGATCTGGG - Exonic
1007888432 6:45259805-45259827 TTGGTCTTCAAAACTGATGTTGG + Intronic
1008668322 6:53740133-53740155 TTGGTCTTACAAAATTATTTGGG - Intergenic
1008797095 6:55316426-55316448 TTGGCCTTACAAAATGATTGTGG + Intergenic
1012450395 6:99348866-99348888 TTTGTCTCCCAAAATGCTCTGGG - Intronic
1015618463 6:135104558-135104580 TAGGACTTCCAGGATGATGTTGG - Intergenic
1016114725 6:140266058-140266080 TTGGTCTTACAAAATGAATTAGG + Intergenic
1020306017 7:6835498-6835520 TTGGATGTCCACAATCATCTTGG + Intergenic
1021043897 7:15897983-15898005 TTGGCCTTCTAGAATGATTTAGG - Intergenic
1023374690 7:39544388-39544410 TTTGCTTTCCCAAATGATCTGGG + Intergenic
1024377055 7:48652152-48652174 TTGGTCTTCCAAGTTGCTCTTGG + Intergenic
1026253783 7:68693207-68693229 TTTGACTTCCAAAATGTTATAGG + Intergenic
1027836052 7:83244686-83244708 TTGGCCTCACAAAATGAACTTGG + Intergenic
1028100977 7:86820323-86820345 TTTGACTTCCATCAGGATCTTGG + Intronic
1028914065 7:96239267-96239289 TTGAAAATCCAAAATGATCTTGG - Intronic
1029602076 7:101572446-101572468 TTGTATTTCCATAATAATCTTGG + Intergenic
1029876604 7:103760723-103760745 TTTGAATTCCAAAATGATTCAGG - Intronic
1030884908 7:114924466-114924488 TTGCATTTCTAAAATCATCTGGG + Intronic
1031447232 7:121870440-121870462 TTGGATTTACAAAATGCTCCAGG + Intergenic
1031485650 7:122320408-122320430 TGGCATTTCAAAAATGATCTTGG + Intronic
1031841268 7:126742436-126742458 TGGGACTTTAAAAAAGATCTGGG + Intronic
1032316721 7:130844955-130844977 TAAGACTTCCCAAATGGTCTTGG + Intergenic
1034096021 7:148408410-148408432 ATGGACTTCCAAGATTATCCGGG - Intronic
1036034666 8:5005869-5005891 TTGTACTCTCAAAATGACCTGGG - Intergenic
1036818548 8:11920500-11920522 TTGGATGTCCACAATCATCTTGG + Intergenic
1037577678 8:20223439-20223461 TTGGATTTAGAAAATGCTCTAGG - Intronic
1037636209 8:20702851-20702873 TTGGTCTTCCAGAGTGATCTGGG + Intergenic
1037945151 8:22985041-22985063 TTGATCTTCCCAAATGATCGTGG + Intronic
1038751059 8:30296431-30296453 TTGGCCTTAGAAAATGATCTGGG + Intergenic
1039848169 8:41341011-41341033 CTGGACTTCCCACATGATCGTGG + Intergenic
1040642508 8:49354949-49354971 TTTTACTTACAAAAGGATCTTGG + Intergenic
1040915595 8:52564533-52564555 CTGCCCTTCTAAAATGATCTAGG + Intronic
1041492059 8:58443968-58443990 ATGGACTTCCAACATAATTTAGG - Intronic
1042044433 8:64632814-64632836 TAGGACTTCCAGAATGATATTGG - Intronic
1043106623 8:76121427-76121449 TTGGAAATGCAAAATGAGCTGGG + Intergenic
1043610071 8:82051734-82051756 TTGAAGTTCCAAAAAGTTCTTGG - Intergenic
1044169143 8:89027232-89027254 TTGGAGGTCCAAAATGATCCAGG - Intergenic
1045070063 8:98493707-98493729 TTGGAGTTCCACAGAGATCTGGG - Intronic
1045229326 8:100286695-100286717 TAGAACTTCCAAGATTATCTGGG - Intronic
1046320229 8:112564507-112564529 TTGCATTTCCAAAATCATCAAGG - Intronic
1046996849 8:120533286-120533308 TTGGACTTCCAATATTTTCTAGG + Intronic
1047212022 8:122847972-122847994 ATGGCCTTCCAAACTCATCTTGG + Intronic
1047396886 8:124508889-124508911 CTGGGCTTACAAAATTATCTGGG + Intronic
1047444253 8:124905584-124905606 TTGTACCTCCAAAGGGATCTAGG - Intergenic
1048463945 8:134647034-134647056 TTGGCCTTACAAAATGAGTTGGG - Intronic
1050192445 9:3042024-3042046 TTGGCCTTATAAAATGAGCTGGG - Intergenic
1051740825 9:20250292-20250314 TAGGACTTCCAGAATGATTTTGG - Intergenic
1058987167 9:110219120-110219142 TTGGACTTCCAAAATAAAACAGG + Intergenic
1059248575 9:112867987-112868009 TTGGCCTTTCACAAGGATCTGGG + Intronic
1059867058 9:118526985-118527007 TTGGACTTCCTAAATGTAATTGG - Intergenic
1060176837 9:121503424-121503446 ATGCACTTCCAGAATGTTCTTGG + Intergenic
1060532919 9:124358883-124358905 TTACATTTCCCAAATGATCTGGG + Intronic
1060652815 9:125344688-125344710 TTGGCCTCCCAAAAAGAGCTGGG - Intronic
1186563882 X:10641652-10641674 TTGGCCTTATAAAATGAACTAGG - Intronic
1186800658 X:13089286-13089308 TTGAATATCCAGAATGATCTAGG - Intergenic
1186836056 X:13439191-13439213 CTGGGCTTCCAAAATTATGTGGG + Intergenic
1188754770 X:33948931-33948953 TTGGCCTTATAAAATGAGCTTGG - Intergenic
1188772562 X:34171593-34171615 TTGGGCTGCCAAAATTGTCTAGG - Intergenic
1188951950 X:36387333-36387355 TTGGACTTAGAAGATGATCCTGG + Intergenic
1189199433 X:39179595-39179617 TTGGACTTATAAAATGAGCTGGG + Intergenic
1191816766 X:65253874-65253896 GTGCACTGCCAAAATGATCTGGG - Intergenic
1196096364 X:111804955-111804977 TTGCACTTTCAGAATGATATTGG + Intronic
1196742993 X:119041763-119041785 TTTAACTTCCAAAATGATTTGGG - Intergenic
1198865036 X:141113453-141113475 TTGGCCTCCCAAAATGCTATGGG - Intergenic
1198897649 X:141473935-141473957 TTGGCCTCCCAAAATGCTATGGG + Intergenic
1200306994 X:155036805-155036827 TTGTACTGCCAAATTGATCTAGG + Intronic
1201563198 Y:15339721-15339743 TTGGACTTATAAAATGAGTTAGG + Intergenic
1201864612 Y:18636434-18636456 TTGGAGCTCCAAATTTATCTGGG + Intergenic
1201868710 Y:18683944-18683966 TTGGAGCTCCAAATTTATCTGGG - Intergenic
1201938267 Y:19431306-19431328 TTCAACTTCCAGAATCATCTGGG + Intergenic