ID: 1158137519

View in Genome Browser
Species Human (GRCh38)
Location 18:54223995-54224017
Sequence GTACCTCCCTGGGGGCGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 4, 3: 19, 4: 282}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158137519_1158137529 25 Left 1158137519 18:54223995-54224017 CCTCCCCGCCCCCAGGGAGGTAC 0: 1
1: 0
2: 4
3: 19
4: 282
Right 1158137529 18:54224043-54224065 CAGCACTTAGCCCAGATTTTCGG 0: 1
1: 0
2: 2
3: 10
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158137519 Original CRISPR GTACCTCCCTGGGGGCGGGG AGG (reversed) Intronic
900344595 1:2204955-2204977 GTGGCGCCCGGGGGGCGGGGCGG - Intronic
900363063 1:2299238-2299260 GTCCCTGCCTCGGGGAGGGGGGG + Intronic
900479636 1:2891787-2891809 GCACAGCCCTGGGGGCTGGGAGG + Intergenic
900591209 1:3460835-3460857 GTCCCTCCCTGGGGCCTGGGAGG + Intronic
901526050 1:9823998-9824020 GTACCCGGCCGGGGGCGGGGTGG + Exonic
903177667 1:21590386-21590408 GCCCCTCCTTGGGGGCGTGGTGG - Intergenic
904750258 1:32737424-32737446 GTTCCTCCCTGGGGACAGGCTGG + Intergenic
905206194 1:36344090-36344112 CTGCCTCCCGGGGGGTGGGGGGG - Intronic
905450121 1:38050907-38050929 GCTCCTGCCTGGGGGCGGGCTGG - Intergenic
905907067 1:41626251-41626273 GCTCCTCCCTGGTGGCTGGGAGG + Intronic
906057455 1:42928123-42928145 GAACATTCCTGGGGGTGGGGTGG + Intronic
906141014 1:43533474-43533496 GGTCCTCCCTGGGGGCGGGGAGG + Intronic
906650354 1:47508444-47508466 GTCCCTCCCTGGGGCCGCCGCGG + Intergenic
908232737 1:62121972-62121994 GTATATCCTTGGGGGCAGGGTGG + Intronic
910231991 1:84997149-84997171 GCAGCCCCTTGGGGGCGGGGCGG - Intergenic
915100300 1:153494589-153494611 GGACCTGCCTAGGGGTGGGGGGG - Intergenic
918174364 1:182029974-182029996 ACACCCCCCGGGGGGCGGGGCGG + Intergenic
918358082 1:183724716-183724738 GGACCTGCCTGGGGCCTGGGGGG + Intronic
922416673 1:225428238-225428260 CACCCTGCCTGGGGGCGGGGAGG + Intronic
1065119796 10:22517230-22517252 GTACATGCCAGGAGGCGGGGGGG - Intergenic
1066080655 10:31928325-31928347 TCTCCTCCCTGGGGGCGGGGCGG + Intronic
1068637454 10:59362932-59362954 CTCCATCCCTGGGGGTGGGGTGG - Intronic
1070162565 10:73874673-73874695 GCCCCTCCCCGGGGGCGGGCCGG - Intergenic
1071379850 10:85047563-85047585 ATACTTCACAGGGGGCGGGGTGG + Intergenic
1071601552 10:86961027-86961049 ATTCCTACCTGGGGGTGGGGCGG + Intronic
1071668174 10:87580926-87580948 GTACATACGTGGGGGCAGGGGGG + Intergenic
1072402757 10:95122292-95122314 TGAACTCCCTGGGGGAGGGGTGG - Intergenic
1072810481 10:98457703-98457725 GTACCAAGATGGGGGCGGGGCGG - Intronic
1073178507 10:101570422-101570444 GGGCCTGGCTGGGGGCGGGGCGG - Intergenic
1073292841 10:102421772-102421794 GGACCCACCTGCGGGCGGGGAGG - Exonic
1075495656 10:122916542-122916564 GTGGCTCCCTTGGGGTGGGGAGG - Intergenic
1075975126 10:126687916-126687938 GTGCTTCCCTGGGGGCGGGGTGG - Intergenic
1076664495 10:132078604-132078626 GACCTTCTCTGGGGGCGGGGGGG + Intergenic
1076833246 10:133007413-133007435 GTGCCTGGCTGGGGGCTGGGAGG - Intergenic
1077052998 11:576077-576099 CTACGTGCGTGGGGGCGGGGTGG + Intergenic
1077219774 11:1410794-1410816 GTGCCTGCCGGGTGGCGGGGGGG - Intronic
1077243631 11:1525076-1525098 GCACCTCTGTGAGGGCGGGGCGG - Intergenic
1077297429 11:1832649-1832671 GCACCTCCCTGGGGTCCCGGCGG + Intronic
1077343793 11:2037347-2037369 GAGGCTCCCTGGGGGCGGTGGGG + Intergenic
1077493233 11:2871704-2871726 GCTCCTCACGGGGGGCGGGGGGG + Intergenic
1078430121 11:11281898-11281920 CTCCCTCCCTGGAGGCTGGGAGG + Intronic
1079103036 11:17553225-17553247 GTCCCTTCCTGGGGGTGGGGTGG - Intronic
1079478715 11:20858715-20858737 ATAGCCCCCTGGGGGTGGGGAGG + Intronic
1081856527 11:46307743-46307765 GTAGCTCCCAGGGGGCAGGCAGG + Intronic
1082814625 11:57499806-57499828 GACCCTCCCTGGCGGCCGGGTGG - Intronic
1083228767 11:61301745-61301767 CCACCTCCAGGGGGGCGGGGAGG + Intronic
1083298964 11:61730356-61730378 CTGCAGCCCTGGGGGCGGGGTGG - Intronic
1083310963 11:61783614-61783636 GGACCTCCCTGGGTGAGGGGAGG - Intronic
1083620529 11:64047193-64047215 GCACCTCTCTGGGGCAGGGGAGG - Intronic
1084275726 11:68050076-68050098 GTGCCTTCCTGGGGGTGGGACGG + Intronic
1084398764 11:68931696-68931718 GAACCTCCCTGGGAGCAGGGAGG + Intronic
1084575502 11:69985833-69985855 GTAACCCCCGGGGGGTGGGGAGG + Intergenic
1084712357 11:70851876-70851898 TTACCAGCCTGGGGGCCGGGAGG - Intronic
1084797549 11:71518806-71518828 GTGTCTGTCTGGGGGCGGGGTGG + Intronic
1087561496 11:99796336-99796358 GTACATCCATTGGGGAGGGGAGG + Intronic
1089254387 11:117186637-117186659 GTACCTCCAGGGGGCCTGGGTGG + Intronic
1089286441 11:117410897-117410919 GAGCCTCCCTGGGGGCTGGTTGG + Intronic
1089616744 11:119699171-119699193 GTACCTACCAGGGGGCCGGCTGG - Intronic
1090241746 11:125188278-125188300 GAACCTCCCTGGGGGTGGGTTGG + Intronic
1202826779 11_KI270721v1_random:92536-92558 GAGGCTCCCTGGGGGCGGTGGGG + Intergenic
1091718227 12:2794915-2794937 GCCCCTCCCTCGCGGCGGGGCGG + Intergenic
1092147254 12:6223213-6223235 GGGCCTCCCTGGGGTTGGGGTGG + Intronic
1092861677 12:12724582-12724604 GTCGCTCCCTGAGGCCGGGGCGG - Intergenic
1093690501 12:22103233-22103255 GAAGCTCCCAGAGGGCGGGGTGG - Intronic
1094848901 12:34373547-34373569 TTTCCTCCGTGGGGGGGGGGGGG + Intergenic
1096178601 12:49538889-49538911 GGACCTCGGCGGGGGCGGGGAGG - Intergenic
1096430370 12:51538158-51538180 GGACCTCCCTGGGTGCGCGGGGG + Intergenic
1096518851 12:52173002-52173024 GGACGCGCCTGGGGGCGGGGAGG - Intronic
1096621951 12:52870708-52870730 GTGCCGCCCTGGGAGCTGGGGGG - Intergenic
1097679822 12:62637976-62637998 GTCCCTGGTTGGGGGCGGGGGGG + Intergenic
1099365014 12:81758312-81758334 CATCTTCCCTGGGGGCGGGGTGG + Intronic
1102029216 12:109730390-109730412 GCACCTGCCTGGGGGGCGGGGGG + Intronic
1103933581 12:124463487-124463509 GCAGCTCCCAGGAGGCGGGGAGG + Intronic
1106235502 13:27857319-27857341 GAGCCTGGCTGGGGGCGGGGGGG + Intergenic
1108615626 13:52129093-52129115 GCGCCTCCCTGCGGCCGGGGCGG + Intergenic
1109124887 13:58505511-58505533 GGAGCCCACTGGGGGCGGGGTGG + Intergenic
1112047911 13:95616236-95616258 GAAGCTCCCTGGGTGCAGGGTGG + Intronic
1113157899 13:107346155-107346177 GTACTTTGTTGGGGGCGGGGGGG + Intronic
1113965194 13:114149024-114149046 GGATCTCCGTGGGGGCTGGGTGG + Intergenic
1116876928 14:50121516-50121538 GTTACTTCCTGGGGGAGGGGGGG + Intronic
1117072506 14:52069298-52069320 GGAGCTCCCTGGGGGCGGAGTGG - Intergenic
1117503074 14:56373941-56373963 GGAGCTCTCTGGGGGAGGGGCGG - Intergenic
1118220974 14:63853772-63853794 GCGCCTCCGCGGGGGCGGGGGGG + Intronic
1118372811 14:65152205-65152227 GGACCTGTCTGGGGGTGGGGGGG + Intergenic
1118957551 14:70497035-70497057 GGAGCTCCCTGGGGTTGGGGTGG + Intergenic
1119041835 14:71281475-71281497 ATACATACCTGGGGACGGGGAGG + Intergenic
1119180892 14:72604717-72604739 GAGCCTCCCTGGGGGCTGGGAGG - Intergenic
1119195866 14:72716151-72716173 ATACCTCCATGGGGAAGGGGAGG + Intronic
1119400284 14:74358253-74358275 GGAGCTCCCCGGGGGCGGGAGGG - Exonic
1120961476 14:90128951-90128973 GTCCCTCTTAGGGGGCGGGGAGG - Intronic
1121011593 14:90523142-90523164 ACACCTCCCTGGGAGCAGGGAGG - Intergenic
1122789595 14:104178725-104178747 GGGCCTCCCTCGGGGTGGGGCGG - Exonic
1123004386 14:105314448-105314470 GCGGCTCCCGGGGGGCGGGGCGG + Exonic
1123056935 14:105575157-105575179 ACACCTGCCTGGGGGAGGGGTGG - Intergenic
1123081275 14:105696628-105696650 ACACCTGCCTGGGGGAGGGGTGG + Intergenic
1123986549 15:25651341-25651363 GTATTTCCCTGGGGATGGGGTGG + Intergenic
1123987144 15:25656035-25656057 GTGCCTACTTGGGGGGGGGGGGG + Intergenic
1128053297 15:64682061-64682083 GTCCCTCCCTGGTGGGCGGGGGG - Exonic
1128151855 15:65368272-65368294 CTTTCTCCCTGGGGGTGGGGAGG + Intronic
1128386997 15:67156795-67156817 GTAGCTGCCTGGGGGTGGGCGGG + Intronic
1128991034 15:72260530-72260552 AGACCTGCCTGGGGGCTGGGAGG + Exonic
1129521971 15:76191868-76191890 GCTCCTGCATGGGGGCGGGGTGG - Intronic
1129725703 15:77900493-77900515 GTGCCTCCAGGGGGGTGGGGCGG + Intergenic
1129744208 15:78007023-78007045 GTGCCTGCCTTGGGGCGGGAAGG + Intronic
1129912415 15:79239633-79239655 CTTCCTCCCTGGGGGAAGGGAGG + Intergenic
1131146991 15:90020481-90020503 GTGTCTCCCCGGGGGCGGGGAGG - Intronic
1132029276 15:98427239-98427261 CAACCTCCCTGGGGGCAGGTAGG + Intergenic
1132556135 16:573455-573477 GCCCCTCCCTGGGGGCAGGAAGG - Intronic
1132557474 16:578959-578981 GCACCTCCCAGGGGGCGGTGGGG - Intronic
1132580781 16:683776-683798 GAACCTCTGCGGGGGCGGGGAGG + Exonic
1132681093 16:1142033-1142055 GTGCCTCCCTGGGGCTGGGCGGG + Intergenic
1132709739 16:1261143-1261165 GGACCTCCCTGATGCCGGGGTGG - Intergenic
1132991581 16:2798407-2798429 GTCGCCCCCTGGGGGCAGGGCGG - Intergenic
1132994739 16:2817191-2817213 GGCGCCCCCTGGGGGCGGGGCGG - Intronic
1133020583 16:2965098-2965120 GGGCCTCCGTGCGGGCGGGGTGG + Intronic
1133119191 16:3595857-3595879 TTACCTCCCTGGTGGAGTGGTGG - Intronic
1133304927 16:4802707-4802729 GAGCCGGCCTGGGGGCGGGGTGG - Exonic
1135861364 16:26058940-26058962 GTTCCAACCTGGGGGCTGGGAGG + Intronic
1136220007 16:28822946-28822968 GGAGCTCCCGGGGGGGGGGGGGG - Intergenic
1136999609 16:35217189-35217211 GTGCCTCCCTGGGTGGGTGGGGG + Intergenic
1137001347 16:35233383-35233405 GTGCCTCCCTGGGTGGGTGGGGG - Intergenic
1137594272 16:49713544-49713566 GAACCTGCCAGGGTGCGGGGAGG - Intronic
1138150775 16:54654854-54654876 GAAGCTCACTGGGGGTGGGGAGG + Intergenic
1138561832 16:57805589-57805611 GTCCCTGCCTGGGGATGGGGTGG - Intronic
1138600614 16:58051851-58051873 GGTCCTCCATGGGGGTGGGGAGG - Intergenic
1139343825 16:66289329-66289351 GCTTCTCCCTGGGGGGGGGGGGG + Intergenic
1139405288 16:66712940-66712962 GTATCTGCCTGGGGGTGGAGTGG - Intergenic
1141300868 16:82814394-82814416 TTTCCTCCCTGGAGGTGGGGTGG - Intronic
1141712383 16:85707666-85707688 GCACAGCCCTGGGGGCTGGGAGG + Exonic
1142130797 16:88430685-88430707 GCGGCTCCCTGGCGGCGGGGAGG + Intronic
1142227576 16:88885067-88885089 GTAGCTCCCGGGGGTCTGGGTGG + Exonic
1142374482 16:89700185-89700207 AGGCCTCCCAGGGGGCGGGGCGG - Intronic
1142603224 17:1067433-1067455 GTTGCTCCCTGCGGGCGGGGCGG - Intronic
1143390495 17:6556622-6556644 GTCCCTCCCCGGCGGCGCGGGGG - Intergenic
1144734943 17:17550056-17550078 GTTCCTCCCTGATAGCGGGGGGG + Intronic
1145887863 17:28395507-28395529 GCACCTCTCTGGAGGCTGGGAGG + Exonic
1146002364 17:29139091-29139113 GTTCCGCCCTGGGGCTGGGGAGG - Intronic
1146619951 17:34389469-34389491 GTATCTCCCTGGCTGAGGGGTGG + Intergenic
1147051354 17:37797084-37797106 ATACCTCCCTGGGTGGAGGGTGG + Intergenic
1147784463 17:42969179-42969201 GAATCATCCTGGGGGCGGGGGGG + Exonic
1148343664 17:46889316-46889338 GTGCCTCCCTGGGCGTGGCGGGG + Intergenic
1148783915 17:50135945-50135967 GTACGTGGCTGGGGGCTGGGCGG - Intronic
1149221008 17:54415195-54415217 GAACCTAACTGGGGGTGGGGGGG - Intergenic
1149975438 17:61261190-61261212 GTACCTCCCTGGGGAGCGGGTGG + Intronic
1150318949 17:64193702-64193724 GTTCCCTCCTGAGGGCGGGGTGG + Exonic
1151791348 17:76307761-76307783 GCACCTCCTTGGGCGCGGGCAGG + Intergenic
1151821968 17:76501414-76501436 GTGGCTCCTCGGGGGCGGGGCGG + Intronic
1152092637 17:78255540-78255562 CTGCCTCCATGGGGGCAGGGTGG + Intergenic
1152429233 17:80238475-80238497 CTGCCTCCCTGGGGGCGAGGAGG - Intronic
1153985685 18:10349040-10349062 GTACGTCCTTGGGGGCTGGGGGG + Intergenic
1155577154 18:27260059-27260081 GGAGCTCCCAGGGGGAGGGGTGG - Intergenic
1157528262 18:48401593-48401615 GTATCTGCCTGGAGGCAGGGAGG + Intronic
1157601041 18:48893482-48893504 GTACCTCCCTGAAGGGAGGGCGG + Intergenic
1157689781 18:49671914-49671936 CTACCTCCTTGGGGCGGGGGCGG + Intergenic
1157712325 18:49858517-49858539 GCCCCTCCCTGGGGGGTGGGGGG - Intronic
1158137519 18:54223995-54224017 GTACCTCCCTGGGGGCGGGGAGG - Intronic
1159928801 18:74291974-74291996 GAACCCCACTGGGGGCTGGGCGG + Exonic
1160950365 19:1664003-1664025 GCATTTCCCTGGGGGTGGGGAGG + Intergenic
1161299891 19:3537554-3537576 GTGCCTCCCCGGGGTCTGGGCGG + Intronic
1161326703 19:3667676-3667698 GGACCTGCCTGGAGGAGGGGAGG + Intronic
1161348534 19:3779610-3779632 GCATCTTCCTGGGGGCGGTGGGG + Exonic
1162913711 19:13863599-13863621 ATACCTCCATGGGGTTGGGGGGG - Intronic
1163484359 19:17577280-17577302 GGCCTTCCCTGGAGGCGGGGCGG + Intronic
1163553807 19:17981623-17981645 GTCACTCTCTGGGGGCGCGGTGG + Intronic
1164527710 19:29023987-29024009 GGACCTCCCTGGAGGCAGGTTGG - Intergenic
1165326041 19:35115263-35115285 ACACCACCGTGGGGGCGGGGAGG - Intergenic
1165509271 19:36256827-36256849 GTACCTACCCGGTCGCGGGGTGG + Intergenic
1165511309 19:36268218-36268240 GTACCTACCCCGTGGCGGGGTGG + Intergenic
1166555910 19:43699787-43699809 GGGCCTCCCGGGCGGCGGGGTGG - Intergenic
1166656516 19:44615896-44615918 GGATCTTCCTGGGGGCGGGAGGG + Intronic
1166959335 19:46488348-46488370 GTCCCTCCCCTGGGGCCGGGAGG + Intronic
1167072289 19:47228127-47228149 CTATCACCCCGGGGGCGGGGCGG + Intronic
1167105831 19:47429570-47429592 GGAGCTCCCTGAGGGCTGGGGGG + Exonic
1167575133 19:50314384-50314406 GCACCTCCCGGGGGTCGGGCTGG - Intronic
1168590811 19:57633155-57633177 GTCCCGCCCTGGGGGGGGCGGGG - Intronic
925208420 2:2026685-2026707 GTACCTCCCGGGCCTCGGGGAGG - Intronic
926101345 2:10120344-10120366 GAGCCTTCCGGGGGGCGGGGCGG + Intergenic
929983070 2:46699151-46699173 ATACCTCCCGGGGCGGGGGGCGG - Intronic
932495022 2:72141986-72142008 TTAGCTCCCTGGGGGTGGGTGGG - Intronic
935592688 2:104856053-104856075 GGGCCACCCTGGGGGCTGGGGGG + Exonic
937100538 2:119264804-119264826 AAACCTCCCTGGCGGGGGGGGGG - Exonic
938377140 2:130815421-130815443 GGCACTCCCTGGGGCCGGGGAGG + Intergenic
940748486 2:157597331-157597353 GGAGCTCCCCGGGGGCGGGCCGG - Intronic
946241638 2:218359558-218359580 GTGCCTCCCTGGAGGCCTGGTGG - Intronic
947181706 2:227417149-227417171 GTACCACCTTAGGTGCGGGGAGG + Intergenic
947531072 2:230908929-230908951 GTCCCTCCCTGGCAGCTGGGAGG - Exonic
947559386 2:231133620-231133642 GTAGTTCCCTGGGGTCAGGGGGG + Intronic
947685273 2:232078384-232078406 CTTCCTCCCGGGGAGCGGGGCGG - Intronic
948111716 2:235461668-235461690 GTTCCTTCCTGGGGGCCCGGGGG - Intergenic
1171521163 20:25774924-25774946 ATGCCTCCCTGGGGCCGGAGTGG - Exonic
1173103645 20:40110788-40110810 ATAGCTCCCTGGGGACAGGGTGG + Intergenic
1173300611 20:41799135-41799157 TTACCTCCCTGGGGGCTGTCAGG + Intergenic
1173848662 20:46203749-46203771 TTGCATGCCTGGGGGCGGGGAGG + Intronic
1174498589 20:50967368-50967390 GGGCCTCCCGGGGGGTGGGGTGG - Intergenic
1174738653 20:52990441-52990463 GTAGCTGCCTTGGGGTGGGGTGG + Intronic
1175202412 20:57287171-57287193 GTTCCTCCCTGGTGGCAGGAAGG + Intergenic
1175521238 20:59604059-59604081 CTCCCTGCCGGGGGGCGGGGGGG - Intronic
1176266876 20:64214096-64214118 GTCTATCCCTGGGGTCGGGGAGG - Intronic
1176546847 21:8205924-8205946 ATACCTCCCCCGGGGCCGGGAGG - Intergenic
1176554752 21:8250133-8250155 ATACCTCCCCCGGGGCCGGGAGG - Intergenic
1176565798 21:8388971-8388993 ATACCTCCCCCGGGGCCGGGAGG - Intergenic
1176573673 21:8433158-8433180 ATACCTCCCCCGGGGCCGGGAGG - Intergenic
1178025049 21:28456724-28456746 GTACCACACTTGGGGCAGGGAGG - Intergenic
1179123363 21:38569171-38569193 GTACCCCACTGGGGGTGGGGGGG - Intronic
1180181389 21:46120116-46120138 GTGCCTCAGTGGGGGCCGGGGGG - Intronic
1181068908 22:20320490-20320512 GTCTCACCCCGGGGGCGGGGAGG - Intergenic
1181478645 22:23183539-23183561 GTCCCTATGTGGGGGCGGGGTGG + Intronic
1181732831 22:24859901-24859923 GTTCCTCCCCGGGGGAGGGGAGG + Intronic
1182060198 22:27391741-27391763 GTGCTGCTCTGGGGGCGGGGGGG + Intergenic
1183105942 22:35615263-35615285 TGGCCTCCCTGGGGGCAGGGTGG - Intronic
1183334272 22:37237705-37237727 CTTCCTCCCCGGGGTCGGGGAGG + Intronic
1184153759 22:42653570-42653592 CTACCTCCCTGGGTGCAGGCAGG - Intergenic
1184161106 22:42697824-42697846 GTAGCTCCCTGGTGACAGGGCGG - Intronic
1184168368 22:42743798-42743820 GAACATCCCTGGAGGCCGGGTGG + Intergenic
1184475018 22:44715628-44715650 GGATCTGCCAGGGGGCGGGGTGG + Intronic
1184555643 22:45231535-45231557 GGCCCTCCCTGGGGAGGGGGTGG - Intronic
1185042328 22:48511426-48511448 GTGGCTCCCAGGGGGAGGGGAGG + Intronic
1185186232 22:49402195-49402217 GGACCTCCCCGGGGGTGGGAAGG + Intergenic
1185383794 22:50522420-50522442 GTGCCTGCCAGGGGGTGGGGTGG + Intronic
1203251722 22_KI270733v1_random:122209-122231 ATACCTCCCCCGGGGCCGGGAGG - Intergenic
1203259772 22_KI270733v1_random:167291-167313 ATACCTCCCCCGGGGCCGGGAGG - Intergenic
950044038 3:9938394-9938416 GTACCTTCCTGGGGAGGGGCGGG + Intronic
950115257 3:10446656-10446678 GCATCTCCCAGGGGGCTGGGAGG - Intronic
950792998 3:15488198-15488220 GCACCAACCTGGGGGCCGGGAGG + Exonic
952572274 3:34731761-34731783 TGAGCTCCCTGGGGGAGGGGCGG + Intergenic
956144674 3:66180698-66180720 ATCCTTCACTGGGGGCGGGGTGG + Intronic
961775005 3:129278568-129278590 GAAACACGCTGGGGGCGGGGAGG + Intergenic
963745134 3:149118169-149118191 GGGCCTCCCTGGGGGTAGGGTGG - Intergenic
964339065 3:155688946-155688968 GGACATGCCTGGGGCCGGGGGGG + Intronic
964652312 3:159026044-159026066 GTTCATCCCTGGGGGGTGGGGGG + Intronic
966597894 3:181742494-181742516 GTGGCATCCTGGGGGCGGGGGGG - Intergenic
967282995 3:187840672-187840694 TTTTTTCCCTGGGGGCGGGGTGG - Intergenic
967904130 3:194486892-194486914 CTACGTCGCTGGCGGCGGGGGGG - Intronic
968235402 3:197028034-197028056 GTGCCTCCCTGTGGGAGGGCAGG - Intronic
968258375 3:197298655-197298677 GCACCTCCCAGGGGGCGGGGAGG + Intronic
969690373 4:8700891-8700913 GGACCTAACTGGGGGTGGGGAGG + Intergenic
969716827 4:8871867-8871889 CGGCCTCACTGGGGGCGGGGAGG + Intergenic
969719924 4:8888004-8888026 TTACCAACCTGGGGGTGGGGGGG - Intergenic
969876812 4:10141525-10141547 GGACCTCCCTGGGGGAGGGGTGG + Intergenic
974885195 4:67809557-67809579 TGAACTCCCTGGGGGAGGGGTGG + Intergenic
984924033 4:184791081-184791103 GGACCTCCCTGTGGGCGGCCAGG - Intronic
988794467 5:34639818-34639840 GTACCTCCTGGAGGACGGGGAGG + Intergenic
990557522 5:56951496-56951518 GCACCTCCCGGGCTGCGGGGTGG + Intronic
991178099 5:63714357-63714379 TTACCTCCCTTGGGGTCGGGGGG + Intergenic
992747114 5:79830592-79830614 CTTCCTGCCTGGGGGCAGGGTGG + Intergenic
994843219 5:104952065-104952087 TGAGCTCCCTGGGGGAGGGGTGG - Intergenic
995906393 5:117129089-117129111 TTATCTCACTGGGGGGGGGGGGG - Intergenic
996962707 5:129270209-129270231 GCACCTCACTGGGGGCAGAGTGG - Intergenic
997253763 5:132411134-132411156 GTTCTGCCGTGGGGGCGGGGAGG + Intronic
997485357 5:134226277-134226299 GTGGCTCCCGGAGGGCGGGGTGG + Intergenic
997634900 5:135398281-135398303 GAGCCTCGCTGGGGGTGGGGTGG - Intronic
999177225 5:149639997-149640019 CTACAGCCCTGGGGGAGGGGAGG + Intergenic
999767976 5:154755412-154755434 GGGCCGCCCCGGGGGCGGGGGGG + Intronic
1001710155 5:173772006-173772028 GTATCTCCCTGTGTGCTGGGAGG + Intergenic
1001770621 5:174293289-174293311 GCTCCTCCCTAGGGGAGGGGTGG + Intergenic
1002350792 5:178582416-178582438 GTCCCTCCCTGGGGCAGTGGCGG - Intronic
1002845288 6:939859-939881 GTCCCTTCCTGGGGCTGGGGAGG - Intergenic
1003626878 6:7749134-7749156 GTACCTCCACCGGGGAGGGGTGG + Intronic
1005427260 6:25715836-25715858 GTTCCTCCCTGGGGGAAGTGGGG + Intergenic
1006333705 6:33410159-33410181 GTTCTTCCCTGGGGCTGGGGTGG - Intergenic
1007513190 6:42390674-42390696 GTACTTTCCTGAGGGCCGGGCGG - Intronic
1008819086 6:55609223-55609245 TGAGCTCCCTGGGGGAGGGGTGG + Intergenic
1012927210 6:105279622-105279644 GCACAGCCCAGGGGGCGGGGAGG + Intronic
1013596078 6:111662263-111662285 GTGGCTGCCTGGGGGAGGGGAGG + Intronic
1016901737 6:149109538-149109560 CTACCTCCCTGAGGGCAGGAAGG + Intergenic
1017768549 6:157626840-157626862 CAACCTCCCTGGGGCTGGGGAGG - Intronic
1018631511 6:165826568-165826590 GTACATACCTGGGGGCGTGGCGG - Intronic
1019559929 7:1650930-1650952 GAACCAGCCTGGGGGAGGGGTGG - Intergenic
1019696685 7:2450322-2450344 TTCCCTCCCTGGGGCCGAGGTGG + Intergenic
1022099635 7:27161514-27161536 GTCCCAACCTGGCGGCGGGGTGG + Intergenic
1022923365 7:35037521-35037543 GTCCCTCCCCGCGGGCCGGGAGG + Intronic
1023177561 7:37448519-37448541 TTTCCTCCCTGGGGGCGCCGCGG - Intronic
1029419651 7:100466192-100466214 GTGGCTGCTTGGGGGCGGGGCGG - Intronic
1030060677 7:105618558-105618580 GTAGCTGCCTGGGGGAGAGGAGG + Intronic
1033243858 7:139702518-139702540 TTCTCTCCCTGGGGGCTGGGGGG + Intronic
1033625302 7:143105290-143105312 GTACCTTCTTAAGGGCGGGGGGG - Intergenic
1035783246 8:2244921-2244943 GAACCTCCCTTAGGGTGGGGTGG + Intergenic
1035808878 8:2474665-2474687 GAACCTCCCTTAGGGTGGGGTGG - Intergenic
1036627646 8:10484600-10484622 GTACTTCCCTGGGTCCTGGGAGG - Intergenic
1037244139 8:16812352-16812374 AAACATTCCTGGGGGCGGGGGGG + Intergenic
1039025410 8:33252910-33252932 TGAACTCCCTGGGGGAGGGGTGG - Intergenic
1046748205 8:117898309-117898331 GTACCTTCCTGTGGGCTGGCTGG + Intronic
1048219815 8:132530878-132530900 ATATCTTCCTGGGGGCGTGGAGG - Intergenic
1048881735 8:138877432-138877454 GTATCTCCCAGGTGGCAGGGTGG + Intronic
1050508309 9:6369628-6369650 GGACCTGCCTGGGGCTGGGGAGG + Intergenic
1051418926 9:16871291-16871313 GCAGCTCCCCGGGGGGGGGGGGG - Intergenic
1054274213 9:63052600-63052622 CTGCCTGCCCGGGGGCGGGGGGG - Intergenic
1054400628 9:64712369-64712391 CTGCCTGCCCGGGGGCGGGGGGG + Intergenic
1054434234 9:65196684-65196706 CTGCCTGCCCGGGGGCGGGGGGG + Intergenic
1057270708 9:93649220-93649242 CTACCACCCTGGGGGTGTGGGGG + Intronic
1057480415 9:95440869-95440891 GGACCTCCCTGAGAGCGGGCAGG + Intergenic
1059549433 9:115214110-115214132 TTAGCTCCCTGGTGGCTGGGAGG + Intronic
1060147895 9:121268081-121268103 GAGCCGCCCTCGGGGCGGGGCGG - Intronic
1061076028 9:128341700-128341722 GAACCTCCCTGGGTTCTGGGTGG + Intronic
1061347951 9:130042472-130042494 GCACTTCCCCGGGAGCGGGGCGG - Intronic
1061579952 9:131530725-131530747 ATACCCCCCAGGGGGCGGGTGGG - Intronic
1062414559 9:136441653-136441675 GTGTCTCCCTGGGGGCGGGACGG + Exonic
1203468124 Un_GL000220v1:105360-105382 ATACCTCCCCCGGGGCCGGGAGG - Intergenic
1203475945 Un_GL000220v1:149332-149354 ATACCTCCCCCGGGGCCGGGAGG - Intergenic
1185641463 X:1591446-1591468 GTGGCACCATGGGGGCGGGGCGG + Intergenic
1186361356 X:8845320-8845342 GGTCCTCCCTGGGGGTGGAGAGG + Intergenic
1186741041 X:12518085-12518107 TGACCTCCCAGGGGGAGGGGTGG - Intronic
1190310428 X:49113587-49113609 GTACCAGCCTGGGGGATGGGAGG + Exonic
1190617663 X:52252827-52252849 GTACTACTCTGGGGGGGGGGCGG - Intergenic
1193679554 X:84501885-84501907 GCACCTTGGTGGGGGCGGGGTGG - Intronic
1198687108 X:139238335-139238357 AGAGCTCCCTGGGGGAGGGGTGG + Intergenic