ID: 1158140446

View in Genome Browser
Species Human (GRCh38)
Location 18:54250003-54250025
Sequence TCTACTGTTTCTAAATATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158140443_1158140446 3 Left 1158140443 18:54249977-54249999 CCTTCCACATTCTGCATACTTGG No data
Right 1158140446 18:54250003-54250025 TCTACTGTTTCTAAATATTTTGG No data
1158140445_1158140446 -1 Left 1158140445 18:54249981-54250003 CCACATTCTGCATACTTGGATAT No data
Right 1158140446 18:54250003-54250025 TCTACTGTTTCTAAATATTTTGG No data
1158140442_1158140446 4 Left 1158140442 18:54249976-54249998 CCCTTCCACATTCTGCATACTTG No data
Right 1158140446 18:54250003-54250025 TCTACTGTTTCTAAATATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158140446 Original CRISPR TCTACTGTTTCTAAATATTT TGG Intergenic
No off target data available for this crispr