ID: 1158140446 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 18:54250003-54250025 |
| Sequence | TCTACTGTTTCTAAATATTT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1158140443_1158140446 | 3 | Left | 1158140443 | 18:54249977-54249999 | CCTTCCACATTCTGCATACTTGG | No data | ||
| Right | 1158140446 | 18:54250003-54250025 | TCTACTGTTTCTAAATATTTTGG | No data | ||||
| 1158140445_1158140446 | -1 | Left | 1158140445 | 18:54249981-54250003 | CCACATTCTGCATACTTGGATAT | No data | ||
| Right | 1158140446 | 18:54250003-54250025 | TCTACTGTTTCTAAATATTTTGG | No data | ||||
| 1158140442_1158140446 | 4 | Left | 1158140442 | 18:54249976-54249998 | CCCTTCCACATTCTGCATACTTG | No data | ||
| Right | 1158140446 | 18:54250003-54250025 | TCTACTGTTTCTAAATATTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1158140446 | Original CRISPR | TCTACTGTTTCTAAATATTT TGG | Intergenic | ||
| No off target data available for this crispr | |||||