ID: 1158142884

View in Genome Browser
Species Human (GRCh38)
Location 18:54275170-54275192
Sequence AATCATAAGGCTGGGTATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 811
Summary {0: 1, 1: 0, 2: 2, 3: 59, 4: 749}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158142880_1158142884 17 Left 1158142880 18:54275130-54275152 CCAGTGATATCATTGCTGGGAGT 0: 1
1: 0
2: 0
3: 9
4: 182
Right 1158142884 18:54275170-54275192 AATCATAAGGCTGGGTATTGTGG 0: 1
1: 0
2: 2
3: 59
4: 749

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158142884 Original CRISPR AATCATAAGGCTGGGTATTG TGG Intronic
900194093 1:1365345-1365367 AAAAATAAGGCTGGGCATGGTGG + Intergenic
901571423 1:10164012-10164034 AATAATAAGGCTGGGCATGGTGG - Intronic
902031448 1:13425708-13425730 AATCCTTAGGCTGGGCATGGTGG - Intergenic
902594335 1:17498047-17498069 AGTCATTAGGCTGGGTGCTGTGG - Intergenic
903046920 1:20571454-20571476 TGTCATAAGGCTTGCTATTGTGG + Intergenic
903051267 1:20602925-20602947 CATCTTAATGCTGGCTATTGTGG + Intronic
903451737 1:23458191-23458213 AAACATGAGGCTGGGCATGGTGG + Intronic
903569903 1:24296706-24296728 AATCATTAGGCTGGGTGCCGTGG + Intergenic
903610013 1:24604285-24604307 AATTATAAGGCTGGGTGCAGTGG + Intronic
904226645 1:29026634-29026656 AATTTTAAGGCTGGGCATGGTGG + Intronic
904545016 1:31262730-31262752 AATTATGAGGCTGGGCATGGTGG + Intronic
905128096 1:35730254-35730276 AAACCTAAGGCTGGGTGTGGTGG + Intronic
905411285 1:37770355-37770377 AGTCAGAAGGCTGGATATGGTGG - Intergenic
905960294 1:42036866-42036888 AATAATAAGGCCGGGCATGGTGG + Intergenic
906342897 1:44996405-44996427 AATAATTAGGCTGGGTGTGGTGG - Intergenic
906636191 1:47412259-47412281 AATCATGAGGATGGGTATCTTGG + Intergenic
907206719 1:52778927-52778949 AAGCATAACGCTAGCTATTGTGG + Intronic
907330576 1:53668646-53668668 AAACATAGGGCTGGGCATGGTGG - Intronic
907999908 1:59669693-59669715 TATCAGAAGGCTGGAAATTGGGG - Intronic
908199347 1:61778301-61778323 AATATTGAGGCTGGGTATGGTGG - Intronic
908730208 1:67218634-67218656 AAAATTAAGGCTGGGTATGGTGG + Intronic
909724747 1:78820902-78820924 AAAAATAGGGCTGGGTATGGTGG - Intergenic
910188080 1:84566915-84566937 AAAGATAAGGCTGGGTGTGGTGG - Intronic
910257690 1:85264762-85264784 ACTCATCAGGCTGGGTGTGGTGG + Intergenic
910675825 1:89815687-89815709 ATTCATAGGGCTGGGTGTGGTGG - Intronic
911430767 1:97783677-97783699 AATAACAAGGCTGGGTGTGGTGG - Intronic
912569605 1:110611733-110611755 AAAAAAAAGGCTGGGTATAGTGG + Intronic
912859655 1:113202458-113202480 ACTCATAACGCTTGGTACTGTGG - Intergenic
912934907 1:113994388-113994410 ATTCATAAGAATGGGTCTTGGGG - Intergenic
913237617 1:116798424-116798446 AATTATGAGGCTGGGCATGGTGG + Intergenic
913280274 1:117178875-117178897 ATTCATAAGGCTGGGTGTGGTGG - Intronic
913437559 1:118862988-118863010 CTCCATAAGCCTGGGTATTGTGG - Intergenic
913590774 1:120322635-120322657 AAACATTGGGCTGGGTATGGTGG - Intergenic
913617466 1:120576021-120576043 AAACATTGGGCTGGGTATGGTGG + Intergenic
914572806 1:148934898-148934920 AAACATTGGGCTGGGTATGGTGG - Intronic
914600038 1:149195307-149195329 AAACATTGGGCTGGGTATGGTGG + Intergenic
914861385 1:151389143-151389165 AATAATAAGGCTGGGCGTGGTGG - Intergenic
915114355 1:153586791-153586813 CATCCTAAGGCTGGGCATGGTGG + Intergenic
915243820 1:154542513-154542535 CATCCTAGGGCTGGGTATGGTGG - Intronic
915419711 1:155770235-155770257 AAACAAAAGGCTGGGCATAGTGG + Intronic
915472317 1:156133283-156133305 AAGCATACGGCTGGGTGTGGTGG + Intronic
916287428 1:163124792-163124814 AAACATTAGGCTGGGGAGTGGGG - Intronic
916441252 1:164827222-164827244 AATTGTAAGGCTGGGAACTGAGG + Intronic
916542962 1:165774716-165774738 AACCATGAGGCTGGGTGTGGTGG - Intronic
917085681 1:171303876-171303898 AATCATAAGGCTGGGTGCAGTGG + Intergenic
917940092 1:179910049-179910071 AAACATGAGGCTGGGTGTGGTGG - Intronic
918057538 1:181035011-181035033 AATCATATGGCTGGGAGTGGTGG + Intronic
918168582 1:181974271-181974293 AATGATTAGGCTGGGCATGGTGG + Intergenic
918606177 1:186428954-186428976 TATAATAAGGCTGGGCATGGTGG + Intergenic
919075336 1:192806835-192806857 ACTTTTCAGGCTGGGTATTGTGG - Intergenic
919092670 1:192993411-192993433 CATAAGAAGGCTGGGTATTGTGG - Intergenic
919446765 1:197714258-197714280 ATTGATAAGGCTGGGTACAGTGG - Intronic
919643136 1:200065070-200065092 AATCTGAAGGCTGGGCATGGTGG - Intronic
919874558 1:201854021-201854043 ATTCATTAGGCTGGGCATGGTGG - Intronic
920014687 1:202897098-202897120 AATCATAAGGCTGTCGAATGGGG + Intronic
920707308 1:208263104-208263126 AATCAGAAGTGTGGGTAATGTGG + Intergenic
921054430 1:211533461-211533483 AAAAAAAAGGCTGGGTGTTGTGG + Intergenic
921435576 1:215116427-215116449 AAGCATACTGCTGGGTATTTGGG - Intronic
922232348 1:223698087-223698109 AGGCATAATGCTGGGTACTGAGG - Intergenic
922694788 1:227724442-227724464 AATGAAAAGGGTGGGTATTGGGG - Intergenic
922741863 1:228018677-228018699 AAATATAAGGCTGGGCATGGTGG - Intronic
922787641 1:228290940-228290962 GATCATGAGGCTGGGTGTGGTGG + Intronic
923153292 1:231254097-231254119 AAGCAGAAGGCTGGGCATGGTGG - Intronic
923688106 1:236168137-236168159 AATCTTAAGGCCGGGTGTGGTGG + Intronic
924342016 1:243046691-243046713 GAAAATAAGGCTGGGCATTGTGG - Intergenic
924473812 1:244366449-244366471 AAACATGAGGCTGGGTGTTGTGG - Intronic
924513029 1:244743461-244743483 AATCATAGGGCTGGGTGCGGTGG - Intergenic
1065082006 10:22138365-22138387 AAAAATAAGGCTGGGCATGGTGG - Intergenic
1065675234 10:28166692-28166714 AAAGATAAGGCTGGGTGTGGTGG - Intronic
1065737767 10:28770101-28770123 AAAAATAAGGCTGGGCATGGTGG - Intergenic
1066998697 10:42586434-42586456 AAACAAAAGGCTGGGTGCTGTGG - Intronic
1067995923 10:51273221-51273243 AATCAGAAGGCTAGGCATCGTGG + Intronic
1068922596 10:62500298-62500320 AATCAGAAGACTGTGTGTTGTGG + Intronic
1068991189 10:63152707-63152729 ATTCATAAGACTGGGCATGGTGG + Intronic
1068994979 10:63192129-63192151 AAGGCTAAGGCTGGGTATGGTGG + Intronic
1069050057 10:63782852-63782874 AAAGATAAAGCTGGGTATGGTGG + Intergenic
1069472550 10:68705918-68705940 AATAATAGGGCTGGGCATGGTGG + Intergenic
1070118742 10:73554831-73554853 GACCATAAGGCTGGGCACTGTGG + Intronic
1071084812 10:81857376-81857398 AAACACAAGGCTGGGCATGGTGG - Intergenic
1071842816 10:89490590-89490612 AAGCATAAGGCAAGGTATGGGGG + Intronic
1072127606 10:92461126-92461148 TATTATAGGGCTGGGTATGGCGG - Intronic
1072231767 10:93419842-93419864 AATTTTAAGGCTGGGCATGGTGG + Intronic
1073122212 10:101129393-101129415 AAGCAGAAGGCTGGGCATGGTGG - Intronic
1073307013 10:102510831-102510853 AATAATTAGGCTGGGTGTGGTGG + Intronic
1074150610 10:110756334-110756356 AAGCACCATGCTGGGTATTGTGG + Intronic
1074279653 10:112038832-112038854 TAGCATAAGGCTGGGCATGGTGG + Intergenic
1074461125 10:113637634-113637656 CATCATTAGGCTGGGTGTGGTGG + Intronic
1075260440 10:120958787-120958809 ATTCATAGGGCTGGGCATGGTGG - Intergenic
1075339853 10:121638044-121638066 AATAATAAGGCTAGGCATGGTGG - Intergenic
1075384567 10:122046185-122046207 AATAATAGGGCTGGGTGTGGTGG + Intronic
1075394804 10:122119624-122119646 GAACATCAGGCTGGGTATCGTGG + Intronic
1075459000 10:122603343-122603365 AATTTTAAAGCTGGGTGTTGGGG + Intronic
1075459632 10:122607402-122607424 AATTTTAAAGCTGGGTGTTGGGG + Intronic
1075460264 10:122611461-122611483 AATTTTAAAGCTGGGTGTTGGGG + Intronic
1075460896 10:122615520-122615542 AATTTTAAAGCTGGGTGTTGGGG + Intronic
1075691112 10:124394877-124394899 CATCTTAAGGCTGGGCACTGTGG + Intergenic
1075816379 10:125267550-125267572 AATGATAAGTCAGGGTATTTAGG + Intergenic
1076274426 10:129184864-129184886 AATGATTAGGCTGAGTACTGAGG - Intergenic
1076504140 10:130960778-130960800 GAGGCTAAGGCTGGGTATTGGGG + Intergenic
1077012195 11:384299-384321 AATGATAAGGCTGGGCATAGTGG + Intergenic
1077072981 11:685855-685877 AAAAATTAGGCCGGGTATTGTGG + Intronic
1077821325 11:5744623-5744645 AAACAAAAGGCTGGGTGTGGTGG + Intronic
1078676111 11:13415941-13415963 GTTCATAAGGCTGGGTGTGGTGG - Intronic
1078768454 11:14323157-14323179 AATTAGAAGGCTGGGTACAGTGG + Intronic
1079118687 11:17660177-17660199 AATCAACAGGCTGGGTGTGGTGG + Intergenic
1079386582 11:19985401-19985423 AATCACAAGCCTGGGCACTGGGG - Intronic
1079490633 11:20985507-20985529 AATCATAAAGCTGTGTGATGAGG + Intronic
1080372390 11:31666294-31666316 AATCTGAAGGCTGGGTGTGGTGG - Intronic
1081370073 11:42289840-42289862 AATCACATAGCTGGGTACTGTGG - Intergenic
1081401620 11:42649659-42649681 AATAATAGGGCCGGGTATGGTGG + Intergenic
1081580798 11:44350305-44350327 AAAAAAAAGGCTGGGTATAGTGG - Intergenic
1081651377 11:44826269-44826291 AAAAATTAGGCTGGGCATTGTGG + Intronic
1081977351 11:47244139-47244161 AATAAATAGGCTGGGTATGGCGG + Intronic
1082046428 11:47732828-47732850 AATCTTAAGGCCGGGCATGGTGG + Intronic
1082768764 11:57189307-57189329 CCTCAGAAGGCTGGGTAGTGGGG + Exonic
1083780648 11:64915689-64915711 AAGCCTAGGGCTGGGTATGGTGG + Intronic
1084131882 11:67142361-67142383 AAAAATAAGGCTGGGTGTGGTGG + Intronic
1084185913 11:67471097-67471119 AATAATAAGGCAGGGCACTGTGG - Intergenic
1084762854 11:71284864-71284886 AACCATAAGTGTGGGGATTGGGG + Intergenic
1084852210 11:71950935-71950957 AATAATGAGGCTGGGTATGGTGG + Intronic
1084963366 11:72729628-72729650 CATCCTAGGGCTGGGTATGGTGG + Intronic
1085290371 11:75394846-75394868 AATCCAAAGGCTGGGCATGGTGG - Intergenic
1085321534 11:75577145-75577167 AATCAGAAGGCTGGGTGCGGTGG - Intergenic
1086112176 11:83211656-83211678 AAGAAAAAAGCTGGGTATTGTGG + Intronic
1086737968 11:90330152-90330174 AATAATAAGGCAGGGTAATTGGG - Intergenic
1086939648 11:92782307-92782329 AATTAAAAGGCTGGGTACAGGGG + Intronic
1087006312 11:93475595-93475617 AAACATTAGGCTTGGTAATGAGG + Intergenic
1087055060 11:93926683-93926705 AATAATCAGGCTGGGCACTGTGG + Intergenic
1087858535 11:103124155-103124177 AATAATGAGGCTGGGTGTGGTGG + Intronic
1088134453 11:106537335-106537357 AAACATAAGGCTGGAAATAGAGG - Intergenic
1088614384 11:111609607-111609629 AATTTGAAGGCTGGGTATGGTGG - Intronic
1088857200 11:113766727-113766749 ATCCATGAGGCTGGGTATAGTGG + Intronic
1088865793 11:113846701-113846723 AATTATCAGGCTGGGCACTGTGG + Intronic
1089267591 11:117277053-117277075 AATTATTAGGCTGGGTATAGTGG + Intronic
1090123322 11:124056189-124056211 AATTATCTGGCTGGGTATGGTGG + Intergenic
1090440484 11:126721241-126721263 AATCATGAGGCCGGGCATGGTGG + Intronic
1090446624 11:126770062-126770084 ACTCAGAAGGCTTGGAATTGCGG - Intronic
1090514306 11:127409338-127409360 TATCAAGAGGCTGGGTATGGTGG - Intergenic
1090800011 11:130164704-130164726 AATAATAAGGCTGGGTGTGGGGG - Intronic
1091628925 12:2143862-2143884 AATCGAAAGGGTGGGCATTGGGG - Intronic
1092185142 12:6473279-6473301 AAAAATATAGCTGGGTATTGTGG + Intergenic
1092489065 12:8928501-8928523 AATCAGAAGGCTCGTTACTGTGG - Intronic
1094484375 12:30912782-30912804 AAAGATTAGTCTGGGTATTGTGG + Intergenic
1094599106 12:31892847-31892869 AAACATCAGGCTGGGTGTGGTGG + Intergenic
1094720898 12:33063095-33063117 AATAATGAGGCTGGGTACAGGGG - Intergenic
1095269784 12:40204061-40204083 AGTAATAAGGCTGGGCATGGTGG - Intronic
1095304400 12:40622677-40622699 AATGATAGGGCTGGGCTTTGTGG + Intergenic
1095347845 12:41172562-41172584 AATAATAAGGCTGGGTGCAGTGG - Intergenic
1095704075 12:45219090-45219112 AATTCTAAGGCTGGGTACAGTGG - Intronic
1096017649 12:48293017-48293039 AATCATAAGGCTGAAGAATGGGG - Intergenic
1096377120 12:51121751-51121773 AATCATTGGGCTGGGTGTGGTGG - Intronic
1097004741 12:55907954-55907976 AAAAATAAGGCTGGGCATGGTGG + Intronic
1097070075 12:56348372-56348394 AATAATAAGGCCGGGTGTGGTGG - Intronic
1097124827 12:56765792-56765814 AATCATGAGGCTGGGCACAGTGG - Intronic
1097239965 12:57568436-57568458 AATCATATGGCTGGGCACGGTGG + Intronic
1097286344 12:57880142-57880164 AAACGTAAGGCTGGGTATTTGGG + Intergenic
1097432267 12:59524812-59524834 AATCAAATGGCTGGGCATGGTGG - Intergenic
1097632065 12:62076582-62076604 ACACATAAGTCTGTGTATTGTGG + Intronic
1097909767 12:64957402-64957424 ATTCATAATGCTGGGTGTGGTGG - Intergenic
1098083113 12:66810699-66810721 TATCACAATGCTGGGGATTGGGG - Intergenic
1098270841 12:68768952-68768974 AAACATTAGGTTGGGTATGGTGG + Exonic
1098413998 12:70212830-70212852 AATCATTAGGCTGGGCACAGTGG - Intergenic
1099614543 12:84917726-84917748 AAACATATTGCTGGGTACTGTGG - Intergenic
1100278447 12:93094283-93094305 AATCTCAAGGCTGGGCATGGTGG + Intergenic
1100366216 12:93923126-93923148 AATATTAAGGCTGGGCACTGTGG + Intergenic
1100485815 12:95025917-95025939 CATCTTAAGGCTGGGTGTGGTGG + Intronic
1100544810 12:95591430-95591452 ATTCATGAGGCCAGGTATTGAGG + Intergenic
1100986327 12:100204650-100204672 AAAAATAAGGCTGGGCATGGTGG - Intronic
1101092429 12:101301378-101301400 AAAAATAAGGCTGGGTGTGGTGG + Intronic
1101128224 12:101661599-101661621 AATAATTAGGCTGAGCATTGTGG + Intronic
1102102984 12:110295104-110295126 AATGAAAAGGCTGGGCATGGTGG - Intronic
1102121423 12:110444570-110444592 AATCACAAGGCTGGGTGCGGTGG - Intronic
1102187676 12:110962295-110962317 AATCATCAGGCTGGGCATGGTGG - Intergenic
1102335174 12:112072649-112072671 AAATATAAGGCTGGGTGTGGTGG + Intronic
1102839789 12:116106555-116106577 TATTATAAGGCTGGGTACAGTGG + Intronic
1103574309 12:121865700-121865722 AATCAAGAGGCTGGGTGTGGTGG + Intergenic
1104514452 12:129411640-129411662 AATAATTAGGCTGGGCATGGGGG - Intronic
1105066985 12:133209545-133209567 AATAAAAAGGCTGGGCATGGTGG + Intergenic
1105512844 13:21065493-21065515 AGTCATGAGGCTGGGCATGGTGG + Intergenic
1105869223 13:24489320-24489342 AATCATATGGCTGGGCGTGGTGG + Intronic
1106107716 13:26748419-26748441 AAACTTAAGGCTGGGTGTGGTGG + Intergenic
1107183040 13:37484607-37484629 ACTCATACAGATGGGTATTGTGG - Intergenic
1107283967 13:38768562-38768584 AAAAATAAGGCTGGGCATGGTGG - Intronic
1107691488 13:42957859-42957881 AATATTAAGGCTGGGTATGGTGG - Intronic
1108566235 13:51701233-51701255 AATAACAAGGCTGGGTGTGGTGG + Intronic
1109640073 13:65180137-65180159 AATCACAAGGCTGGGCATGGTGG - Intergenic
1110797546 13:79657644-79657666 AAAAATAAGGCTGGGTAAAGTGG - Intergenic
1110850812 13:80242309-80242331 AATGATTAGGCTGGGCATGGTGG - Intergenic
1111670243 13:91320861-91320883 AATTTTAAGGCTGGGTGTGGTGG + Intergenic
1111687719 13:91522010-91522032 ATATATAAGGCTGGGTATGGAGG + Intronic
1111862723 13:93728526-93728548 TAAAATAAGGCTGGGTATGGTGG - Intronic
1112385087 13:98931883-98931905 AAGAATAAGGCTGGGTGTGGTGG - Intronic
1112833651 13:103485757-103485779 ATTCATCAGGCTGGGCATGGTGG + Intergenic
1113259273 13:108543776-108543798 CATGATAAGGCTGGGCATGGTGG + Intergenic
1113275626 13:108726271-108726293 ACTCGTAAGGCTGGGTGTGGTGG + Intronic
1114041235 14:18680618-18680640 AATAATAAGCCTGGGCATGGTGG - Intergenic
1114431218 14:22662884-22662906 AAAAATAAGGCTGGGCATGGTGG - Intergenic
1114478161 14:23012481-23012503 AATAATAAGGCCGGGTGTGGTGG + Intergenic
1114541278 14:23461568-23461590 AATTGTTAGGCTGGGTATTGTGG + Intergenic
1114641722 14:24227805-24227827 AATCATTCGGCTGGGCATGGTGG + Intronic
1114687064 14:24543346-24543368 AATCACAAGGGTGGTGATTGGGG - Intergenic
1114933837 14:27507875-27507897 AATTAAAAAGCTGGGTGTTGTGG - Intergenic
1115243797 14:31274654-31274676 AATAATATGGCTGGGCATGGTGG + Intergenic
1115611353 14:35051402-35051424 AAAAATAAGGCTGGGTGCTGTGG - Intronic
1115768103 14:36644623-36644645 AATTTGAAGGCTGGGTATGGTGG - Intergenic
1115820631 14:37209369-37209391 TAACATAAGGCTGGGCATGGTGG + Intronic
1116190588 14:41660311-41660333 AGTCATATGGCTGGGTGTGGTGG - Intronic
1116797554 14:49408097-49408119 AATCAAAGGACTGGATATTGGGG - Intergenic
1116856756 14:49959370-49959392 AATCAACAGGCAGGGTATGGTGG - Intergenic
1116945872 14:50834764-50834786 AAACATCAGGCTGGGCATGGTGG + Intergenic
1117835913 14:59805948-59805970 AATTATATGGCTGGGCACTGTGG + Intronic
1118082349 14:62375308-62375330 AATCATAAGGCTGGGTGCAGTGG + Intergenic
1118145539 14:63131104-63131126 AATTATAAGGCTGGGTGCGGTGG + Intergenic
1118174633 14:63425743-63425765 ATTAATAAAGCTGGGTATTGTGG + Intronic
1118403554 14:65401608-65401630 AATAAAAAGGCTGGGCATGGTGG + Intergenic
1118424138 14:65639731-65639753 GATCATAAAGCTGGGTGATGAGG - Intronic
1118914105 14:70087051-70087073 AATCATAAGGCTTTGGATAGTGG - Intronic
1119092198 14:71794584-71794606 CACTATAAGGCTGGGTATAGTGG - Intergenic
1119097839 14:71850660-71850682 AATAATAAGGCTGGGCACAGTGG + Intergenic
1119251486 14:73158747-73158769 AAATATAAGGCTGGGCATAGAGG - Intronic
1119255269 14:73190198-73190220 AATTTTAAGGCTGGGTGTGGTGG + Intronic
1119549796 14:75500259-75500281 AAAAATAAGGCTGGGCATGGTGG + Intergenic
1120013525 14:79444535-79444557 AATCAAAGGGCTGGGCATGGTGG + Intronic
1120265918 14:82251012-82251034 CAACATAAGGATGGCTATTGAGG + Intergenic
1120811218 14:88805403-88805425 AATCATTGGGCTTGGTATTATGG + Intergenic
1120814182 14:88836770-88836792 AAACTTAAGGCTGGGCATGGTGG + Intronic
1121024011 14:90600896-90600918 ATTCATGAGGCTGTGTCTTGGGG + Intronic
1122002919 14:98678545-98678567 AATCTTAAGGCTGGGCACGGTGG + Intergenic
1122191823 14:100051032-100051054 AATAATAAGGCTGGGTGCAGTGG - Intronic
1122483868 14:102065409-102065431 AAACATTAGGCTGGGCATGGTGG - Intergenic
1124072073 15:26404809-26404831 AATAATAAGGCTGGGCACAGTGG + Intergenic
1124227800 15:27910668-27910690 AAACATACGGCTGGGTGTGGTGG + Intronic
1124944202 15:34247990-34248012 AGTCAGAGGGCTGGGTATGGTGG - Intronic
1125477809 15:40059412-40059434 AATAACAAGGCTGGGCATAGTGG - Intergenic
1125695842 15:41636700-41636722 AAAAATTAGGCTGGGTATGGTGG - Intronic
1125964296 15:43860792-43860814 AATCATTTGGCTGAGTGTTGTGG - Intronic
1126443223 15:48714261-48714283 TATAATAAGGCTGGGCATGGTGG - Intronic
1126642733 15:50844080-50844102 ACTCATAGGGCTGGGTGTGGTGG + Intergenic
1127086906 15:55432656-55432678 AAGCAAAAGGCTGGGCATGGTGG + Intronic
1127828717 15:62730325-62730347 AAACATAAGGCTGGGTGCGGTGG - Intronic
1128049590 15:64652309-64652331 AAAAATAAGGCTGGGCATGGTGG - Intronic
1128463232 15:67887270-67887292 AATAAAAAGGCCGGGCATTGTGG - Intergenic
1128649778 15:69402019-69402041 AATAAAAAGGCTGGGCATGGTGG - Intronic
1128989412 15:72246433-72246455 AATAATGAGGCTGGGCATGGTGG - Intronic
1129478473 15:75803966-75803988 AATCATTAGGCTGGGCACAGTGG - Intergenic
1130288873 15:82579108-82579130 AATTTTAAGGCTGGGCATGGTGG - Intronic
1130297164 15:82655589-82655611 CATCAAAAGGATGGGTGTTGAGG - Intergenic
1131479755 15:92770687-92770709 AAGCTTGAGGCTGGGTATAGTGG - Intronic
1131892735 15:96991346-96991368 AATAATATGCCTAGGTATTGGGG + Intergenic
1131921077 15:97329296-97329318 ATACATAAGGCTGGGTGTGGTGG - Intergenic
1132150947 15:99458415-99458437 AAACCTCAGGCTGGGTATGGTGG + Intergenic
1132324039 15:100951662-100951684 AATAATAAGGCCGGGCATAGTGG + Intronic
1132369130 15:101281120-101281142 AAACTAAAGGCTGGGTATGGTGG + Intergenic
1132425645 15:101714314-101714336 AATGATAAGGCTGGGCACAGTGG + Intronic
1132427237 15:101728308-101728330 AATAACAAGGCTGGGTGTGGTGG + Intergenic
1133151842 16:3839391-3839413 ATTCATAAGGCTGGGTGAGGTGG + Intronic
1133466290 16:6030204-6030226 CATCATAGGGCTGGGCATAGTGG - Intronic
1133754318 16:8751234-8751256 AAAAATTAGGCTGGGTATAGTGG - Intronic
1133785592 16:8970742-8970764 AGTTTTAAGGCTGGGTATGGTGG - Intergenic
1133881209 16:9784140-9784162 AATTATATGGCTGGGTGTGGTGG + Intronic
1134355610 16:13479328-13479350 ATTCATAGGTCTGGGTATTAAGG + Intergenic
1134450476 16:14360272-14360294 AAACATCAGGCTGGATATAGTGG + Intergenic
1134477408 16:14587619-14587641 AATTAGAAGGCTGGGTGTGGTGG - Intronic
1135012409 16:18893768-18893790 AACCAGAAGGCTGGGCATGGTGG + Intronic
1135099978 16:19596729-19596751 AATGAAAAGGCTGGGCATGGTGG + Intronic
1135319269 16:21481025-21481047 AACCAGAAGGCTGGGCATGGTGG + Intergenic
1135372165 16:21912818-21912840 AACCAGAAGGCTGGGCATGGTGG + Intergenic
1135439621 16:22457886-22457908 AACCAGAAGGCTGGGCATGGTGG - Intergenic
1135553468 16:23416314-23416336 AAACATCAGGCTGGGTGTGGTGG - Intronic
1135744569 16:25005201-25005223 AATATTCAGGCTGGGTATGGTGG - Intronic
1135981441 16:27150624-27150646 AGTCATAAGGCTGGGCGTGGTGG - Intergenic
1136241901 16:28949971-28949993 AATAATAAGGCTGGGCGTGGTGG - Intergenic
1137350161 16:47706360-47706382 AGGCATAAGGCTGGGTATGGTGG - Intergenic
1137588964 16:49681916-49681938 AATCATAATGTTGGGCATGGTGG - Intronic
1138614016 16:58150196-58150218 AATAATGAGGCTGGGCATGGTGG + Intergenic
1138667449 16:58583824-58583846 AATTTTCAGGCTGGGCATTGTGG - Intronic
1138741930 16:59321017-59321039 AATTATAGGGCTGGGCATGGTGG + Intergenic
1139273414 16:65704553-65704575 AAAAATAAGGCTGGGCATGGTGG + Intergenic
1139686328 16:68606465-68606487 AATGATAAGGCCGGGCATGGTGG + Intergenic
1139718458 16:68833313-68833335 AATCATAAGGCGGGGCTGTGGGG - Exonic
1139751315 16:69110389-69110411 AATAATAAGGCCGGGTGTGGTGG - Intronic
1140037217 16:71380593-71380615 AATCCTGAGGCTGGGCATGGTGG - Intronic
1140698101 16:77554992-77555014 TATCATGAGGCTGGGAATGGTGG - Intergenic
1140757586 16:78082071-78082093 AATTATGAGGCTGGGTACAGTGG + Intergenic
1140829387 16:78737422-78737444 ATATATAAGGCTGGGCATTGTGG - Intronic
1140988540 16:80185047-80185069 AAACATCAGGCTGGGTGTGGTGG + Intergenic
1141048238 16:80736621-80736643 GAAAATAAGGCTGGGTATAGTGG + Intronic
1141316667 16:82968830-82968852 AATAATAAGGCTGGGTGTAGTGG + Intronic
1141507242 16:84485967-84485989 AATAATAAGGCTGGGCGTGGTGG - Intronic
1141587258 16:85042704-85042726 AATGGTAATGCTGGGCATTGTGG + Intronic
1141960289 16:87401815-87401837 AGTCATCAGGCTGGGCATGGTGG - Intronic
1142786880 17:2231408-2231430 AAGCATAAGGCTGGGTGCAGTGG + Intronic
1143021823 17:3920838-3920860 AAAAAAAAGGCTGGGCATTGTGG - Intergenic
1143064494 17:4234794-4234816 AATTTTAAGGCCGGGTATGGTGG - Intronic
1143105632 17:4529365-4529387 AAACATGAGGCTGGGCATGGGGG - Intronic
1143403266 17:6659413-6659435 AATTATAAGGCTGGGCACAGTGG + Intergenic
1143619723 17:8073936-8073958 GATCATAAGGCTGGGGACGGAGG + Intronic
1144766411 17:17735339-17735361 AAAAAAAAGGCTGGGCATTGTGG - Intronic
1145012174 17:19375468-19375490 AATAATAAGGCTGGGTACTGTGG + Intronic
1145913968 17:28559900-28559922 TGTCATAAGGGTGGGTACTGGGG - Intronic
1146544119 17:33723614-33723636 AATCATAGGGCTGGGTGCAGTGG - Intronic
1146698646 17:34933067-34933089 AGTCATAAGGCCGGGTGTGGTGG - Intronic
1147046786 17:37758477-37758499 AAAAATAAGGCTGGGCATGGTGG + Intergenic
1147225086 17:38970217-38970239 AAACATAAGGCTGGGCACAGTGG - Intergenic
1147246992 17:39128505-39128527 AATTATAGGGCTGGGTGCTGTGG - Intronic
1147330098 17:39693799-39693821 AATAATAGGGCTGGGTGTGGTGG + Intronic
1147514054 17:41099098-41099120 ATTAATCAGGCTGGGTGTTGGGG - Intronic
1147516153 17:41119312-41119334 ATTAATCAGGCTGGGTGTTGGGG - Intergenic
1147776091 17:42902534-42902556 AATCATGCGGCTGGGTGTAGTGG - Intronic
1148028339 17:44603586-44603608 AATTATAAGGCTGGGTGCAGTGG - Intergenic
1148227576 17:45909582-45909604 AATAATTAGGCTGGGTGTGGTGG + Intronic
1148416500 17:47510681-47510703 AGTGCTAGGGCTGGGTATTGTGG - Intergenic
1148604532 17:48919032-48919054 AAACACAAGGCTGGGCATGGTGG - Intronic
1148925414 17:51080593-51080615 CATCTTAAGGCTGGGTGTGGTGG + Intronic
1149562343 17:57617781-57617803 AAACATTAGGCTGGGCATGGTGG + Intronic
1149744447 17:59081980-59082002 AATAATAATGCTGGGCATGGTGG + Intronic
1149781998 17:59405178-59405200 AAATATAAGGCTGGGCATGGCGG - Intergenic
1150216088 17:63470741-63470763 GATCATAAGGCTTGTTAATGTGG + Intergenic
1150356988 17:64495290-64495312 AATCATGAGGCTGGGCACTGTGG + Intronic
1150364233 17:64567143-64567165 AAGCTTAAGGCTGGGCATGGTGG - Intronic
1150727167 17:67660831-67660853 ATTCATGAGGCTGGGCATGGTGG - Intronic
1151432532 17:74073394-74073416 CATCCTAACGCTGGGTTTTGGGG - Intergenic
1151580397 17:74974325-74974347 AATAATAGGGCTGGGCATGGTGG - Intergenic
1151592942 17:75058510-75058532 AATAATAAGGCTGGGTGCGGTGG + Intronic
1151605569 17:75133251-75133273 AATCAATAAGCTGGGTATGGTGG + Intergenic
1151641758 17:75400457-75400479 GAGCATGAGGCTGGGTATGGTGG - Intronic
1151734641 17:75931494-75931516 AACCATAGGGCTGGGTGTGGGGG + Intronic
1151764883 17:76127906-76127928 AATAAAAAGGCTGGGCATGGTGG - Intergenic
1151764972 17:76128589-76128611 AAGCATAAGGCTGGGCATGGTGG + Intergenic
1152423078 17:80204469-80204491 AATCATGGGGCTGGGTGTGGTGG + Intronic
1153086251 18:1291960-1291982 ACTCTGAAGGCTGGGCATTGTGG + Intergenic
1154219255 18:12437673-12437695 AATCATACGGCTGGGCGTGGTGG - Intergenic
1154960462 18:21303130-21303152 AAACATAGGGCTGGGCATGGTGG - Intronic
1155143129 18:23061329-23061351 AAAAATAAGGCTGGGTGTGGTGG - Intergenic
1155473191 18:26212144-26212166 AAACATAAGGCTGGGCACGGTGG + Intergenic
1155662883 18:28272894-28272916 AAAAATATGGCTGGGTACTGTGG + Intergenic
1155951998 18:31923857-31923879 AATAATAAGGCCGGGTGTGGTGG + Intronic
1156247944 18:35320971-35320993 AATCAATAAGCTGGGTATAGTGG + Intergenic
1156690441 18:39700731-39700753 AATCATATAGCTGAGTGTTGAGG + Intergenic
1158142884 18:54275170-54275192 AATCATAAGGCTGGGTATTGTGG + Intronic
1158268444 18:55686058-55686080 AATTATAAGGCTGGGTGTGGTGG + Intergenic
1158353319 18:56587751-56587773 AATTATATGGCTGGGCATGGTGG - Intergenic
1158523383 18:58190836-58190858 GATAAAAAGGCTGGGTATGGTGG + Intronic
1158526074 18:58215097-58215119 AAACACCAGGCTGGGTATGGTGG - Intronic
1158987760 18:62836147-62836169 AATTAAAAGGCTGGGAATGGTGG + Intronic
1160259997 18:77284087-77284109 AATTATAAGGCTGGGTGTGGTGG + Intergenic
1160954386 19:1683690-1683712 AATAATAAGGCTGGGTGTGGTGG + Intergenic
1161385797 19:3992099-3992121 AAAAAAAAGGCTGGGTATGGTGG - Intergenic
1161429985 19:4225962-4225984 AATCCTAAGGCTGGCCATGGTGG + Intergenic
1161748969 19:6080373-6080395 AATCCTCAGGCTGGGTGTCGTGG - Intronic
1161796626 19:6390617-6390639 AATAAAAAGGCTGGGCATGGTGG + Intronic
1161900022 19:7111413-7111435 AATAATAAGGCTGGGTGTGGTGG + Intergenic
1161976195 19:7609032-7609054 AATTATAGGGCTGGGTGTGGTGG + Intronic
1162678153 19:12316121-12316143 AATCTGAAGGCTGGGTGTGGTGG + Intergenic
1163175751 19:15563300-15563322 AATCATGAGGTTGGGAATTCAGG - Intergenic
1163530616 19:17846870-17846892 AATAAAAAGGCTGGGCAATGTGG - Intronic
1163758010 19:19118332-19118354 TTTCATCAGGCTGGGTATGGTGG - Intergenic
1163775981 19:19217989-19218011 AATAATAAGGCTGGGTGTAGTGG + Intronic
1163891459 19:20019922-20019944 AAGAATAGGGCTGGGTATGGTGG + Intronic
1163936251 19:20446996-20447018 AATTATAAGGCTGGGCATGGTGG - Intergenic
1164002374 19:21113795-21113817 GATCATATGGCTGGGCATGGTGG - Intronic
1164216180 19:23151316-23151338 AATCAAAAGGCTGTGTATGGTGG + Intergenic
1164336444 19:24325844-24325866 AATTATAAAGCTGGGTATCTGGG - Intergenic
1164747904 19:30629481-30629503 AATTATCAGGCTGGGCATGGTGG - Intronic
1164898666 19:31899449-31899471 AGTCATGAGGCTGGGCATTTTGG - Intergenic
1164903748 19:31949879-31949901 AAACATTAGGCTGGGTGTGGTGG + Intergenic
1165207394 19:34202091-34202113 AATAATAAGGGTGGGCATGGTGG - Intronic
1165891377 19:39114390-39114412 AAACCTAAGGCTGGGCACTGTGG + Intergenic
1167274162 19:48525670-48525692 AAAAATCAGGCTGGGTGTTGTGG - Intergenic
1167614070 19:50521886-50521908 AAAAATAAGGCTGGGCATGGTGG + Intronic
1167815739 19:51879280-51879302 AATAATATGGCTGGGCATGGTGG + Intronic
1167858178 19:52259852-52259874 AAAAATAAGGCTGGGTGTGGTGG - Intergenic
1167971296 19:53188983-53189005 AAAAATAAGGCTGGGCATGGTGG - Intronic
1168021075 19:53609178-53609200 AGACATATGGCTGGGTATTGTGG + Intergenic
1168150239 19:54443028-54443050 TATCATAAGGCTGGGCGTGGTGG + Intergenic
1168654068 19:58113980-58114002 AATAATAAGGCTGGGCGTGGTGG + Intronic
925219708 2:2128437-2128459 AAGCTTAAGGCTGGGTGTAGTGG - Intronic
925525970 2:4802878-4802900 AAACATAAGGCTTGGCATGGTGG + Intergenic
926769280 2:16353582-16353604 AATAATTAGGCTGGGTGTGGTGG - Intergenic
926771211 2:16377540-16377562 AAAAGTAAGGCTGGGTATGGTGG + Intergenic
926906067 2:17806814-17806836 GAACAGAAGGCTGGGTATGGTGG + Intergenic
927042474 2:19243540-19243562 AATCATAAAATTGGGTATTTAGG + Intergenic
927133306 2:20079044-20079066 AAGGAGAAGGCTGGGCATTGGGG + Intergenic
927621886 2:24669848-24669870 AAAGATAAGGCTGGGTGCTGTGG + Intronic
928075421 2:28260181-28260203 ATTCAGAAGGCTGGGTGTGGTGG - Intronic
928400508 2:30974826-30974848 AGTCATCATCCTGGGTATTGAGG - Intronic
928569374 2:32588070-32588092 ATTAATAAGGCTGGGTGTGGTGG + Intronic
928657821 2:33471467-33471489 AAAAATAAGGCTGGGAATAGTGG - Intronic
928789953 2:34938452-34938474 AATTATAGGGCTGGGTGTGGTGG - Intergenic
929343365 2:40850298-40850320 AATAAGAAGGCTGGGTGTGGTGG - Intergenic
929883456 2:45857698-45857720 AATCAAAATGCTGGGTGTGGTGG - Intronic
930132386 2:47865778-47865800 AATCATATAGCTAAGTATTGGGG - Intronic
930430357 2:51267727-51267749 GATCTTAAAGCTGGGTGTTGTGG + Intergenic
930501909 2:52232208-52232230 AACTATAAGGCTGGGTGCTGTGG + Intergenic
930509042 2:52321659-52321681 AATAATGAGGCTGGGCATGGTGG + Intergenic
930684599 2:54294622-54294644 AATCTTGAGGCTGTGTATGGTGG + Intronic
930746082 2:54884884-54884906 AATCATTGGGCTGGGCATGGGGG + Intronic
931659588 2:64546745-64546767 CATCACAAGGCTGGGCATGGTGG + Intronic
931746571 2:65296357-65296379 AATCTTAAGGCCGGGTACGGTGG - Intergenic
932082237 2:68725612-68725634 AATAATCAGGCTGGGCATGGTGG - Intronic
933794818 2:85911215-85911237 AATGATTAGGCTGGGCATGGTGG - Intergenic
933916993 2:87005553-87005575 AAATATAAGGCTGGGCATGGTGG + Intronic
934006002 2:87764361-87764383 AAATATAAGGCTGGGCATGGTGG - Intronic
934483731 2:94680358-94680380 AATGATAAGGCTGGGCGTGGTGG - Intergenic
935029236 2:99306172-99306194 AATCATGAGGCAGGGTGTGGTGG - Intronic
935140833 2:100351540-100351562 GCTCATAAGGCTGGGTATGGTGG + Intergenic
935151071 2:100436521-100436543 TTTCATAAGGCTGGGTGTGGTGG + Intergenic
935242814 2:101192981-101193003 AATCAGAAGGCCGGGCATGGTGG - Intronic
935321160 2:101890740-101890762 AATAAAAAGGCTGGGCATGGTGG - Intronic
935693261 2:105748703-105748725 AACCATAGGGCAGGGTATGGTGG - Intronic
935697036 2:105779017-105779039 CATCATAAGGCTGGGCACAGTGG + Intronic
935799377 2:106678328-106678350 TATCTTAAGGCTGGGTGTGGTGG + Intergenic
936282346 2:111153088-111153110 AAACACAAGGCTGGGTACGGTGG + Intronic
936554837 2:113486464-113486486 AATCTTTAGGCTGGGTGTGGTGG + Intronic
937417848 2:121731185-121731207 AATGATATGGCTGGGTACAGTGG + Intronic
937716987 2:125043526-125043548 AGTGATAAGGCTGGGTGTGGTGG + Intergenic
937742951 2:125377380-125377402 AAACATAAGGCTGGACATGGTGG + Intergenic
938268963 2:129951898-129951920 AATAATAAGGCTGGGCAAGGTGG + Intergenic
938305860 2:130253607-130253629 AATCACGAGGCCGGGCATTGTGG - Intergenic
938448295 2:131394165-131394187 AATCACGAGGCCGGGCATTGTGG + Intergenic
938924180 2:136024229-136024251 AGGCATAAGGCTGGGCATGGTGG - Intergenic
939565835 2:143785433-143785455 AATCCTGAGGCTGGGTGTGGTGG + Intergenic
939616671 2:144369129-144369151 AACCATATGGCTGGGAATAGGGG - Intergenic
939906377 2:147921184-147921206 AAACATTAGGCTGGGCATGGTGG - Intronic
940309189 2:152259059-152259081 AATAATCAGGCTGGGTGTGGTGG - Intergenic
941109584 2:161404194-161404216 AATAATTAGGCTGGGCATAGTGG - Intronic
941363336 2:164580378-164580400 TATCATAAGGCTGGGCATGGTGG - Intronic
941387912 2:164875776-164875798 AATAATAAGGCTGGGTGCGGTGG - Intergenic
941937492 2:170996284-170996306 AATAATAAGGCTGGGCGTGGTGG - Intronic
942188532 2:173447806-173447828 AATCATTGGTCTGGGTGTTGTGG + Intergenic
942311079 2:174657603-174657625 AATCAGAAGGCTGGGTACAGTGG + Intronic
943341111 2:186683325-186683347 AAACATAAGCCTTGGTATTCAGG + Intergenic
943668334 2:190633781-190633803 AATGATAAGGCCAGGTACTGTGG + Intergenic
943684146 2:190799027-190799049 AATTATAAGGCTGGGTGTGGTGG - Intergenic
944245095 2:197522616-197522638 AATCATCAGACTGGGCATGGTGG - Intronic
944441355 2:199746812-199746834 AATTATAATGCTGGGGATGGAGG - Intergenic
945805775 2:214488308-214488330 AGTCACAAGGCTGGGCATGGTGG + Intronic
946379618 2:219337053-219337075 AATAATAAGGTTGGGTACAGTGG + Intergenic
946648206 2:221862882-221862904 AATGATCAGGCTGGGCATGGTGG - Intergenic
947175109 2:227358433-227358455 AATCTCAAGGCTGGGTGTGGTGG + Intergenic
1168895832 20:1322856-1322878 AAACAAAAGGCTGGGCATAGTGG - Intronic
1169162919 20:3397603-3397625 AATCATAAGGCTGGGCGTGGTGG - Intronic
1169239252 20:3961112-3961134 AAGGATAAGGCTGGGTGTGGTGG + Intronic
1169467492 20:5854291-5854313 AAACATAAGGCCGGGTGTGGTGG - Intronic
1170138998 20:13106533-13106555 AATCAGGAGGCTGTGTGTTGGGG + Intronic
1170217485 20:13906964-13906986 AATTATAAGGCCGGGTGTGGTGG - Intronic
1170638206 20:18128065-18128087 AAACAAAAGGCTGGGTGTGGTGG + Intergenic
1170914455 20:20609284-20609306 AACCAAAAGGCTGGGCATGGTGG - Intronic
1172199964 20:33118491-33118513 GACCATCAGGCTGGGTGTTGAGG - Intergenic
1172318362 20:33974691-33974713 AATAAGAAGGCTGGGTGTGGTGG - Intergenic
1172335136 20:34109815-34109837 AAACAGAAGGCTGGGCATGGTGG + Intronic
1172738398 20:37146518-37146540 AATAATAAGGCTGGGCGTGGTGG + Intronic
1173264573 20:41467579-41467601 AAAAAAAAGGCTGGGTGTTGTGG + Intronic
1173447823 20:43136178-43136200 ATTCATAAAACTGGGTATTCTGG - Intronic
1173618899 20:44421464-44421486 AATGAAAAGGCTGGGTGTGGTGG + Intronic
1173830814 20:46086163-46086185 TATCTTAAGGCTGGGTACAGTGG - Intronic
1173930505 20:46814119-46814141 AATAATAAGGCTGGGTGCAGTGG + Intergenic
1174316410 20:49705890-49705912 AATCATAAGGCCGGGTGCAGTGG + Intronic
1174802357 20:53575054-53575076 AAGAATAAGGCTGGGTATGGTGG + Intronic
1174815937 20:53686961-53686983 AATAATATGGCTGGGTGTGGTGG + Intergenic
1176288445 21:5031779-5031801 GACCATAGGGCTGGGTATGGTGG - Intronic
1177091587 21:16775909-16775931 AATCATGAGGCAGGGAATGGGGG - Intergenic
1177500426 21:21947824-21947846 TATCAGAAGGCTGGATAATGGGG - Intergenic
1178289400 21:31354122-31354144 AATAATAAGGCCGGGCATGGTGG - Intronic
1178324845 21:31636433-31636455 ATTAATAAGGCTGGGCATGGTGG - Intergenic
1179868737 21:44231696-44231718 GACCATAGGGCTGGGTATGGTGG + Intronic
1180168724 21:46046245-46046267 AAAAAAAAGGCTGGGTATGGTGG + Intergenic
1181606871 22:23985558-23985580 AATCATAAGGGTGTTGATTGGGG + Intergenic
1182509974 22:30812139-30812161 AATGAGAAGGCTGGGTGTGGTGG - Intronic
1182595503 22:31417082-31417104 AATAATAAGGCCGGGCATGGTGG + Intronic
1182635652 22:31724683-31724705 AATCATCAGGCTGGGCACAGTGG - Intronic
1183388911 22:37532416-37532438 AAAAATAAGGCTGGGTGTGGTGG - Intergenic
1183907455 22:41052533-41052555 AATCATTAGGCCGGGCATGGTGG - Intergenic
1184001456 22:41677235-41677257 AATGATGAGGCTGGGCATGGTGG + Intronic
1184005090 22:41701860-41701882 TATTATAAGGATGGGTTTTGGGG + Intronic
1184404920 22:44294494-44294516 AAGCATGAGGCTGAGTTTTGGGG - Intronic
1184517586 22:44972099-44972121 AATGACAGGGCTGGGTCTTGGGG + Intronic
1184558054 22:45243954-45243976 AATCAAAAGGCTGTGTGCTGTGG + Intergenic
1184743930 22:46445204-46445226 AAAAATAAGGCTGGGTGTAGTGG + Intronic
949780120 3:7676972-7676994 AAAAATAAGGCTGGGCATGGTGG + Intronic
951591436 3:24269721-24269743 TAACTTAAGGCTGGGTACTGTGG - Intronic
952170607 3:30802810-30802832 ACTGATAAGGCTGGGCACTGTGG + Intronic
952467770 3:33608990-33609012 AACCTTAAGGCTGGGCGTTGTGG + Intronic
952481431 3:33765638-33765660 AATAATCAGGCTGGGCATTTTGG + Intergenic
952941605 3:38449406-38449428 AAAAATAAGGCTGGGCATGGTGG - Intergenic
953323843 3:41996041-41996063 AATAATAGGGCTGGGTGTGGTGG - Intergenic
953362871 3:42314457-42314479 AATGATAGGGCTGGGTGTGGTGG - Intergenic
953938205 3:47065509-47065531 ATTCTTAAGGCTGGGCATAGTGG + Intronic
954310129 3:49760181-49760203 AATAATTAGGCTGGGCATGGTGG - Intronic
954323629 3:49849130-49849152 AATTTTATGGCTGGGTATGGTGG - Intronic
955171017 3:56565576-56565598 AATTATATGGCTGGGTGTGGTGG - Intronic
955284630 3:57627429-57627451 AAACATTAGGCTGGGTGTGGTGG - Exonic
955295194 3:57728594-57728616 AATAATAAGGCCGGGTACGGTGG + Intergenic
955309244 3:57867971-57867993 AAACATAAGGCTGGGTGTGGTGG + Intronic
955690420 3:61585381-61585403 AGTCATAAGACTGCGTGTTGAGG - Intronic
956118479 3:65942072-65942094 AAAGCTAAGGCTGGGTATGGTGG - Intronic
956710997 3:72038798-72038820 AATCATTAGGCTGGGTGCGGTGG + Intergenic
956773345 3:72545503-72545525 TATCATCAGGCTGGGTGTGGTGG - Intergenic
957572790 3:81969829-81969851 TATCACACGGCTGGGTATGGTGG - Intergenic
957575942 3:82008359-82008381 AATTATCAGGCTGGGTGTGGTGG - Intergenic
958068426 3:88576519-88576541 AATCCAAAGTCTGGGTATTGTGG + Intergenic
959709915 3:109375357-109375379 AAACAGAAGGCTGGGCATGGTGG - Intergenic
959934794 3:112018118-112018140 AAGCATAAGGCTGGGCATGGTGG - Intergenic
960102954 3:113764082-113764104 AATCAAAAAGCTGGGCATGGTGG + Intronic
960380294 3:116951931-116951953 AATGTTAAGGCTGGGACTTGAGG - Intronic
961058229 3:123807139-123807161 AATCTTATGGCTGGGCATGGTGG + Intronic
961466730 3:127086221-127086243 AACGTTAAGGCTGGGTATGGTGG + Intergenic
961593420 3:127997852-127997874 AATCATAAGTCTTGGCTTTGGGG - Intergenic
962018885 3:131475370-131475392 AAGGATAAGGCTGGGTCTGGTGG + Intronic
962303273 3:134262850-134262872 AATTCTAAGGCTGGGCATGGTGG + Intergenic
962441301 3:135419868-135419890 AGTGATAAGGCTGGGCATGGTGG + Intergenic
962578265 3:136774290-136774312 AATAAAAAGGCTGGGTGTGGTGG - Intergenic
963047253 3:141111896-141111918 AACCATAAGGCAGGGCTTTGAGG - Intronic
963232426 3:142921851-142921873 AATCATAAGGCTGGGCACGGTGG - Intergenic
964101647 3:152994775-152994797 AATTAAGAGGCTGGGTATGGTGG - Intergenic
964304011 3:155321454-155321476 AGTCATAAAGCTGGGAAATGTGG + Intergenic
964788030 3:160421214-160421236 AATTATAGGGCTGGGTGTGGTGG - Intronic
965076429 3:163983455-163983477 AATAATAAGACTGGATTTTGGGG + Intergenic
965362358 3:167756595-167756617 AATTTTAGGGCTGGGTGTTGCGG - Intronic
965493943 3:169374743-169374765 GAACATAAGGCTGGGCATGGTGG + Intronic
965628706 3:170708409-170708431 AATAATAAGGCTGGGTGTGGTGG + Intronic
965646372 3:170885875-170885897 AAAAATAAGGCTGGGCATGGTGG - Intergenic
965705409 3:171501268-171501290 AATCATTAGGCCAGGTATGGTGG - Intergenic
967046301 3:185740133-185740155 AATAAAAAGGCCGGGTATGGTGG - Intronic
967304372 3:188046282-188046304 TCTCATAAGGCTTGGCATTGGGG + Intergenic
967489003 3:190067130-190067152 AAGAATAAGGCTGGGTGTGGTGG - Intronic
968246437 3:197154013-197154035 AAAAATAAGGCTGGGTGTGGTGG + Intronic
968337959 3:197929816-197929838 AAACAGAAGGCTGGGCATGGTGG + Intronic
968414474 4:418319-418341 AAACATTAGGCTGGGTATGGTGG + Intergenic
969459215 4:7319415-7319437 AAGCATGAGGCTGGGCATGGTGG + Intronic
969782768 4:9422460-9422482 ATTCCTAAGGCTGTGAATTGGGG - Intergenic
970419925 4:15896520-15896542 AAATTTAAGGCTGGGTATGGTGG + Intergenic
971494139 4:27246327-27246349 GATCTTAAGGCTGGGCATGGTGG + Intergenic
971765738 4:30828637-30828659 AAACATAAGGCTGGTTACTATGG + Intronic
971814416 4:31467524-31467546 AATCATAAGGCAGCATATTATGG + Intergenic
972045558 4:34661326-34661348 AATAATAAGGCTGGGTGTGGTGG - Intergenic
972551578 4:40140077-40140099 AAAAATAAGGCTGGGCATGGTGG - Intronic
972724463 4:41734216-41734238 AGCCATTAGGCTGGGTATGGTGG - Intergenic
973664507 4:53144157-53144179 AAATATAAGGCTGGGCATGGTGG + Intronic
973773049 4:54224073-54224095 AATAATAAGGCTGGGTGCAGTGG - Intronic
973966369 4:56166391-56166413 ACTCATTTGGCTGGGTATGGTGG + Intergenic
974009046 4:56590614-56590636 AACCATAAGGCTGGGTGTGGTGG - Intronic
974044967 4:56891099-56891121 AAACACCAGGCTGGGTATGGTGG + Intergenic
975066642 4:70074533-70074555 AATTATTAGGCTGGGCATGGTGG + Intergenic
975133600 4:70852084-70852106 GATCATGAGGCTGGGCATGGTGG - Intergenic
975208218 4:71668550-71668572 AATCATAAGGCTGGGCACGGTGG - Intergenic
975638335 4:76473318-76473340 AATGACAAGGCTGGGTGTGGTGG + Intronic
976252622 4:83068680-83068702 ATTCATGAGGCTGGGCATGGCGG + Intronic
976916452 4:90381180-90381202 TATCACAAGGGTGGGTAGTGGGG - Intronic
976959084 4:90944380-90944402 AATAATAAGCCTTGATATTGGGG - Intronic
977025255 4:91810589-91810611 AATAATAAGGCTGGGTGCAGTGG + Intergenic
977420218 4:96790138-96790160 AATCTAAATGCTGGCTATTGTGG + Intergenic
977931904 4:102758809-102758831 AATCATCAGGCTGGGCACAGTGG - Intronic
978240467 4:106509090-106509112 AATAATATGGCCGGGTATGGTGG - Intergenic
978429301 4:108616994-108617016 AATCATCAGGCTGGGCGTGGTGG - Intergenic
978580526 4:110227205-110227227 AAACAAAAGGCTGGGCATGGTGG + Intergenic
979053774 4:115970643-115970665 AAAAATAAGGCTGGGCATGGTGG - Intergenic
979347084 4:119601193-119601215 AATCACAAGGTTGGGTTTTCTGG - Intronic
979482423 4:121235377-121235399 AAACATAAGGCTGGACATGGTGG + Intergenic
979829931 4:125286447-125286469 AATAATATGGCCGGGTATGGTGG - Intergenic
979958837 4:126991065-126991087 AATCCTTAGGCTGGATATAGTGG + Intergenic
980118369 4:128703319-128703341 AAGTACAAGGCTGGGTATGGTGG - Intergenic
980178044 4:129370946-129370968 AAACCTAAGGCTGGTTAGTGTGG - Intergenic
980919621 4:139070128-139070150 AATTACAAGGCTGGGTGTGGTGG - Intronic
981724586 4:147834180-147834202 ACTCATTAGGCTGGGAATGGTGG + Intronic
981759031 4:148173362-148173384 AATCATAAGGCTCCTTATTGGGG + Intronic
982378755 4:154724981-154725003 AATAATAAAGCTGGGTGTGGTGG + Intronic
982488541 4:155999300-155999322 CAGCATATGGCTGGGCATTGTGG - Intergenic
982641616 4:157968876-157968898 TATGAGAAGGCTGGGTGTTGTGG - Intergenic
982916533 4:161217094-161217116 AATAATAAGGCCGGGTGTGGTGG + Intergenic
983229908 4:165119026-165119048 ATTCATAATGCTGTGTGTTGAGG + Intronic
983686351 4:170413579-170413601 AATTATAAGGCAGGGCATGGTGG - Intergenic
984716667 4:182932068-182932090 AATTATAAGGCTGGCTGCTGTGG + Intergenic
984858376 4:184215430-184215452 AAAAATAAGTATGGGTATTGGGG + Intronic
985219795 4:187692242-187692264 CTTCAGAAGGCTGGATATTGTGG + Intergenic
986154413 5:5159879-5159901 AATCAAAATGCTGGTTATTCTGG - Intronic
986353095 5:6898585-6898607 AAACACAAGGCTGGGTGTGGTGG + Intergenic
986910577 5:12550469-12550491 TATCATAAGGTTGGGCATGGTGG - Intergenic
987236302 5:15945266-15945288 AGTCATCAGGCTGGGCATGGTGG - Intergenic
987482793 5:18479922-18479944 CACCATATGGCTGGGTATTCAGG - Intergenic
988783667 5:34546172-34546194 AATCATAAGGCTGTTAAATGAGG - Intergenic
989384162 5:40837996-40838018 AATAATAAGGCTGGGTGCGGTGG + Intergenic
990257855 5:53989944-53989966 AAGCACAAGGCTGGGCACTGTGG + Intronic
990322185 5:54640770-54640792 AATCAGGAGGCTGGGTGTGGTGG + Intergenic
990394434 5:55361878-55361900 AACAACAAGGCTGGGTATGGTGG - Intronic
991255127 5:64604880-64604902 AATGTTGAGGCTGGGTATGGTGG + Intronic
991454346 5:66786154-66786176 AATTATTAGGCTGGGTACAGTGG - Intronic
991701997 5:69325035-69325057 ACTCATTAGGCTGGGTGTGGTGG + Intronic
992007658 5:72494056-72494078 AATTTTAAGGCTGGGTGTAGGGG - Intronic
992113230 5:73515629-73515651 AATCATGAGGCTGGGTGCAGTGG - Intergenic
992573856 5:78090923-78090945 AAAAAAAAGGCTGGGTATGGTGG - Intronic
995586460 5:113653675-113653697 ATTCATATGGCTGGGGATAGAGG + Intergenic
996816098 5:127573938-127573960 AATCATAAAGTTGGGTATGGTGG + Intergenic
996816184 5:127574856-127574878 AATCAAAAAGTTGGGTATGGTGG + Intergenic
996959564 5:129230585-129230607 AACCATAAGGCTGAGTTTTCTGG + Intergenic
997174884 5:131764933-131764955 CATCATACGGCTGGGTGTGGTGG + Intronic
997247938 5:132367132-132367154 AAATTTAAGGCTGGGTATGGTGG + Intergenic
997298084 5:132782070-132782092 AAGCAGAAGGCTGAGTATTTAGG + Intronic
997460122 5:134046313-134046335 AATGAAAAGGCTGGGCATGGTGG - Intergenic
997534696 5:134610177-134610199 AATAATAAGGCCGGGTGTGGTGG + Intronic
997565512 5:134883137-134883159 AATAATTAGGCTGGGCATGGTGG + Intronic
997868109 5:137482607-137482629 TACCACATGGCTGGGTATTGGGG - Intronic
997932292 5:138082590-138082612 TAAAATAAGGCTGGGTATGGTGG + Intergenic
998178506 5:139917537-139917559 AATAATAAGGCTGGGGACAGTGG - Intronic
998219957 5:140269298-140269320 AGTTATAAGGCTGGGTGCTGTGG - Intronic
998235140 5:140392202-140392224 AATTGTAAGGCTGGGCATGGTGG + Intergenic
998344651 5:141451113-141451135 AATCATAAGGCTGGGTGTGGTGG - Intronic
998981269 5:147705313-147705335 AACAATAAGGCCGGGTATGGTGG + Intronic
999421236 5:151446242-151446264 AAGCATAGGACTGGGTATGGTGG + Intronic
999464725 5:151791939-151791961 AAAAATAAGGCTGGGCATGGTGG - Intronic
999549465 5:152670474-152670496 AATTAGAAGGCTGGGCATAGTGG + Intergenic
999587172 5:153102930-153102952 AAATAGAAGGCTGGGTATGGTGG + Intergenic
999993564 5:157070457-157070479 AATAAGAAGGCTGGGCATGGTGG - Intergenic
1000062159 5:157667443-157667465 AACCTTGAGGCTGGGTATGGTGG + Intronic
1000278610 5:159762633-159762655 AATCATAGGGCTGGGCATGGTGG + Intergenic
1000535772 5:162476738-162476760 AATAATAAGGCTGGGCGTGGTGG - Intergenic
1000615311 5:163419469-163419491 AATTTTAAAGCTGGGCATTGGGG - Intergenic
1001647104 5:173290152-173290174 GATAATAAGGCTGGGTGTGGTGG - Intergenic
1002008747 5:176259177-176259199 AAACATTAGGCTGGGCATGGTGG + Intronic
1002217975 5:177653075-177653097 AAACATTAGGCTGGGTATGGTGG - Intergenic
1002378670 5:178808440-178808462 AAAAATAAGGCTGGGTGTTGTGG + Intergenic
1003628608 6:7766323-7766345 AATCACTAGGCTGGGTGTGGTGG + Intronic
1003685575 6:8298797-8298819 GATAATAAGGCTGGGCATGGTGG - Intergenic
1003857270 6:10289360-10289382 AAACATAAATCTGGGAATTGAGG + Intergenic
1003900553 6:10651237-10651259 AAAAATAAGGCTGGGTACAGTGG - Intergenic
1003915369 6:10781918-10781940 TATTATAGGGCTGGGTGTTGTGG + Intronic
1004192404 6:13475284-13475306 ACTCACAAGGCTGGGCATGGTGG + Intronic
1004356253 6:14932375-14932397 AATCTTTAGGCTGGGCATGGTGG - Intergenic
1004393535 6:15228843-15228865 AAACATTAGGCTGGGCATGGTGG + Intergenic
1004692883 6:18007537-18007559 AATTTTAAGGCTGGGCATGGTGG + Intergenic
1004848723 6:19674298-19674320 AATCTTAAGGCTGGGCATGGTGG + Intergenic
1004885682 6:20049775-20049797 AAAAATGAGGCTGGGTATGGTGG - Intergenic
1005356549 6:24989580-24989602 AAGTACAAGGCTGGGTATGGTGG - Intronic
1005660039 6:27988397-27988419 AATTATTAGGCTGGGTACAGTGG - Intergenic
1006093402 6:31641460-31641482 AATCATAAGACTGGGAGTGGAGG + Intronic
1006546038 6:34782398-34782420 AATCATTAGGCTGGGCGTGGTGG + Intergenic
1006601347 6:35228537-35228559 AACCATAAGGCTGAGTCTGGGGG + Intronic
1006680527 6:35794027-35794049 AATCATAAGGCCGGGCACGGTGG + Intergenic
1007047588 6:38793067-38793089 AATTTTAAGGCTGGGCATGGTGG - Intronic
1007093359 6:39198472-39198494 AATCATCTGGCTGGATATAGGGG + Intronic
1007187288 6:39982950-39982972 AAACACAAGGCTGGGGTTTGAGG + Intergenic
1008217423 6:48810400-48810422 AATCATCAGGCTGGGCACAGTGG - Intergenic
1011249932 6:85360391-85360413 AATTATAAGGCCGGGTGTGGTGG + Intergenic
1011284554 6:85708885-85708907 TATTATAAGGCTCGGTATGGTGG - Intergenic
1012068436 6:94579257-94579279 AAACATGAGGCTGGGCATTGTGG - Intergenic
1012477107 6:99625826-99625848 AATCCTGAGGCTGGGTGTGGTGG + Intergenic
1012582391 6:100884354-100884376 TATCATATGGCTGGGTGTGGTGG + Intergenic
1012932247 6:105329439-105329461 AATTATAAGGCTGGGCGTGGTGG - Intronic
1012964721 6:105661232-105661254 AATAAGAAGGCTGGGCATGGTGG + Intergenic
1012982942 6:105849396-105849418 AATCATAAATCTGGGCATCGAGG + Intergenic
1013128878 6:107212716-107212738 AAAAATAAGGCTGGGCATGGTGG + Intronic
1013235106 6:108191340-108191362 AAGCATTAGGCTGGGCATGGTGG - Intergenic
1013260149 6:108433572-108433594 AATAATAAGGCTGGGCGTGGTGG - Intronic
1013351354 6:109308823-109308845 AACCATATGGCTGGGTGTGGTGG + Intergenic
1013428350 6:110034657-110034679 AATCACAAGGCTGGGTCTGTGGG + Intergenic
1014027105 6:116661511-116661533 CAGCATAAAGCTGGGAATTGGGG + Intronic
1014965410 6:127742021-127742043 AATCACCAGGCTGAGTATGGTGG + Intronic
1015137352 6:129888413-129888435 AATAATAGGGCTGGGCATAGTGG - Intergenic
1015544296 6:134346204-134346226 AACTATCAGGCTGGGCATTGTGG + Intergenic
1016838869 6:148506184-148506206 AATAATAAGGCTGGGCTTGGTGG + Intronic
1017678231 6:156836949-156836971 AATGCTGAGGCTGGGTATGGTGG - Intronic
1018179970 6:161214476-161214498 AAACATAGGGCTGGGCATGGTGG + Intronic
1018490415 6:164286870-164286892 AAGCATAAGGCCGGGCATGGTGG - Intergenic
1018492165 6:164305084-164305106 AATCATAAGGCCGGGTGTGGTGG + Intergenic
1019921420 7:4165775-4165797 AAACACAAGGCTGGGCATGGTGG - Intronic
1020382474 7:7562137-7562159 AAACATAATTCTTGGTATTGAGG + Intergenic
1021227391 7:18044077-18044099 AACCATAAGGATGGGAATAGAGG - Intergenic
1021661494 7:22923867-22923889 AAATAGAAGGCTGGGTATGGTGG + Intergenic
1021888264 7:25161981-25162003 AATTATAAGGCTGGGAGTGGTGG + Intronic
1022082561 7:27037026-27037048 AATAATAAGGTTGGGCATGGTGG + Intergenic
1022301139 7:29103538-29103560 AATCATGAGGCTGGGTGTGGTGG - Intronic
1025600208 7:62987132-62987154 AATCACAAGGCTATGGATTGGGG + Intergenic
1025741209 7:64197753-64197775 AATTTTAAGGCCGGGTATAGTGG - Intronic
1025749447 7:64280686-64280708 AATTTTAAAGCTGGGTGTTGGGG + Intergenic
1026161745 7:67875508-67875530 AATTATAAGCCTGGGCATGGTGG - Intergenic
1026558913 7:71431885-71431907 AATCAACAGGCTGGGCATGGTGG + Intronic
1027110975 7:75439671-75439693 TTTTATAAGGCTGGGTATGGTGG - Intronic
1027424807 7:78051870-78051892 AAAAAAAAGGCTGGGTATGGTGG - Intronic
1027759685 7:82262042-82262064 AAACACAAGGCTGGGTGTGGTGG + Intronic
1027768631 7:82378108-82378130 AATATTAAGGCTGGGTGTGGTGG + Intronic
1028590895 7:92493345-92493367 ACTCTTAAGGCTGGGCATGGTGG + Intronic
1029135219 7:98365765-98365787 AATCAAAAGGCTGGGCGTGGTGG - Intronic
1029463378 7:100709578-100709600 AAAAATAAGGCTGGGTGTGGTGG + Intergenic
1029996949 7:105015128-105015150 ACTGAGAAGGCTGGGTACTGGGG - Intronic
1030044977 7:105486770-105486792 ATTCACAAGGCTGGGCATGGTGG + Intronic
1030298933 7:107956182-107956204 AAAAATTAGGCTGGGTATGGTGG - Intronic
1030538924 7:110804467-110804489 AATCAGAAGGCAGGGTGTTCTGG + Intronic
1030617469 7:111753185-111753207 ATTAATAAGGCTGGGCATGGTGG + Intronic
1032154815 7:129459146-129459168 ATTCATGAGGCTGGGGAATGGGG - Intronic
1032455477 7:132070284-132070306 CATCATAAGGCTCGGGATTCTGG - Intergenic
1032912557 7:136450103-136450125 AATCAGAAGACAGGCTATTGGGG + Intergenic
1033375486 7:140757573-140757595 AATCCTAAGGCTGGGCGTGGTGG - Intronic
1034157584 7:148968265-148968287 AAAAAAAAGGCTGGGTATGGTGG - Intergenic
1034625431 7:152488530-152488552 AATCAACAGGCTGGGTGTGGTGG + Intergenic
1034655551 7:152726909-152726931 AAAAATTAGGCTGGGTATGGTGG + Intergenic
1035116144 7:156525864-156525886 AATTATGAGGCTGGGCATGGTGG + Intergenic
1035892285 8:3358232-3358254 ACTCAGAAGGCTTGGTATTAAGG + Intronic
1036092637 8:5684553-5684575 AATCAAATTGCTGGTTATTGAGG + Intergenic
1036393400 8:8345501-8345523 AATCTTAAGGCTGGGCACAGTGG + Intronic
1036836297 8:12071575-12071597 ATTCCTAAGGCTGTGAATTGGGG + Intronic
1036858139 8:12318144-12318166 ATTCCTAAGGCTGTGAATTGGGG + Intergenic
1037302509 8:17467554-17467576 AAACATAAGGCCGGGTACAGTGG - Intergenic
1037336001 8:17792574-17792596 CATCAGAAGGCTGGGCATGGTGG + Intronic
1037543893 8:19899073-19899095 AAATATGAGGCTGGGCATTGTGG - Intergenic
1037940158 8:22945199-22945221 AAAGATAAGGCTGGGCACTGTGG - Intronic
1038177001 8:25189646-25189668 AAGAATAAGGCTGGGTGTGGTGG - Intronic
1039051908 8:33502840-33502862 AAACAAAAGGCTGGGCATGGTGG + Intronic
1039273287 8:35906758-35906780 AATCATATGCCTGGGTGTGGTGG - Intergenic
1039315520 8:36367564-36367586 AAACACTAGGCTGGGTATGGTGG + Intergenic
1039495821 8:37979300-37979322 CATCATTAGGCTGGGAATGGTGG + Intergenic
1039503611 8:38035503-38035525 AATAATAAGGCCGGGTGTGGTGG - Intronic
1039526857 8:38224769-38224791 ATGCATATGGCTGGGTACTGTGG + Intergenic
1039901956 8:41759016-41759038 AAACACAGGGCTGGGTATGGTGG - Intronic
1039948206 8:42147957-42147979 AAACATATGGCTGGGCCTTGCGG + Intergenic
1040029589 8:42812675-42812697 AATCAGGAGGCTGGGTGTGGTGG + Intergenic
1041070394 8:54122837-54122859 AATGATCAGGCTGGGTGTGGTGG + Intergenic
1042025210 8:64415643-64415665 AAAGATAAGGCTGGGCATGGTGG - Intergenic
1042343798 8:67707619-67707641 AAACTTAAGGCTGGGTGTGGTGG + Intronic
1042539350 8:69892508-69892530 AAGCAGAAGGCCGGGTATGGTGG + Intergenic
1042553081 8:70011616-70011638 AAGAATAAGGCTGGGTGTGGTGG - Intergenic
1042856857 8:73276463-73276485 CATCAGAAGGCTGGGTGTGGTGG - Intergenic
1042886340 8:73556468-73556490 AATCTTAAGGCTGGGTGCTGTGG + Intronic
1042932595 8:74028222-74028244 AATACTAAGGCTGGGTGTGGTGG - Intronic
1044089585 8:87982221-87982243 AATCCTAAGGCTGGGCGCTGTGG - Intergenic
1044813106 8:96083992-96084014 GATTATAAGGCTGGGTACAGTGG + Intergenic
1045162724 8:99567045-99567067 AATAATATGGCTGGGTACAGTGG - Intronic
1045313400 8:101023207-101023229 AATGTTAAGGCTGGGCATGGTGG + Intergenic
1045441012 8:102210748-102210770 AATAATAAGGCTGGGCACAGTGG - Intronic
1045577759 8:103444511-103444533 GATCATCAGGCTGGGCATGGTGG - Intergenic
1045630083 8:104108584-104108606 TAACAAAAGGCTGGGTATGGTGG - Intronic
1045665303 8:104478027-104478049 AAACATAGGGCTGAGTATGGTGG - Intergenic
1045891142 8:107159070-107159092 AATTAAAAAGCTGGGTATGGTGG - Intergenic
1046732448 8:117739964-117739986 AATTATAGGGCTGGGCATTGTGG - Intergenic
1046832184 8:118758647-118758669 AAAAATAAGGCTGGGTACAGTGG + Intergenic
1047072971 8:121368084-121368106 AATAATAAGGCTGGACATGGTGG + Intergenic
1047296916 8:123578698-123578720 AATCACGAGGCTGGGCATGGTGG + Intergenic
1047636698 8:126771286-126771308 AATCATATGGCTGGGCGTGGTGG - Intergenic
1048238172 8:132713130-132713152 AATGACAAGGCTGGGTGTGGTGG - Intronic
1048803014 8:138211778-138211800 AATTATAAGTCTGGGCATGGTGG + Intronic
1048823336 8:138399510-138399532 AACCATATGGGTGGGTCTTGGGG + Intronic
1049677270 8:143896406-143896428 AATCATGAGGCTGGGTGCAGTGG + Intergenic
1049898174 9:130719-130741 AATCTTTAGGCTGGGTGTGGTGG - Intronic
1049947288 9:609338-609360 AATCAATAGGCTGGGCATCGTGG + Intronic
1050546311 9:6712397-6712419 AATGATAAGGCTGGGCACAGTGG + Intergenic
1051238098 9:15023210-15023232 AATCTAAAGGCTGGGTAAAGAGG - Intergenic
1051260396 9:15258277-15258299 AATCATCAGACTTGGTAATGTGG + Intronic
1051404368 9:16719280-16719302 AATCATTAGGGTGGCTATTTGGG - Intronic
1051659300 9:19410420-19410442 AAACCTAAGGCTGGGCGTTGTGG + Intronic
1052370923 9:27663613-27663635 AAACATAGGGCTGGGCATGGTGG - Intergenic
1052844588 9:33323953-33323975 ATTCATTAGGCTGGGTACCGTGG + Intronic
1053028874 9:34757605-34757627 ATTCATATGGATGGGTCTTGGGG + Intergenic
1053128554 9:35602227-35602249 AAACATATGGCTGGGTGTGGTGG + Intergenic
1053178445 9:35946668-35946690 AATCTCAAGGCTGGGTGTGGTGG - Intergenic
1053741241 9:41141013-41141035 AATCTTTAGGCTGGGTGTGGTGG - Intronic
1053741880 9:41148920-41148942 ATTTATAAGGCTGGGTGTGGTGG + Intronic
1054346450 9:63970503-63970525 AATCTTTAGGCTGGGTGTGGTGG - Intergenic
1054486046 9:65724353-65724375 AATCTTTAGGCTGGGTGTGGTGG + Intronic
1054686463 9:68282380-68282402 ATTTATAAGGCTGGGTGTGGTGG - Intronic
1054687108 9:68290279-68290301 AATCTTTAGGCTGGGTGTGGTGG + Intronic
1054766108 9:69043869-69043891 AAACATGAGGCCGGGCATTGTGG - Intronic
1054783900 9:69192023-69192045 AAACATACGGCTGGGCATGGTGG - Intronic
1055107976 9:72532216-72532238 AAACTTCAGGCTGGGTATGGTGG - Intronic
1056769681 9:89467815-89467837 AATCATGAGGCTGGGTGCAGTGG - Intronic
1056966915 9:91170411-91170433 AATATTATGGCTGGGTATAGTGG - Intergenic
1057376040 9:94524037-94524059 AAACAAAAGGCTGGGCATGGTGG - Intergenic
1057534261 9:95883571-95883593 AAACATGAGGCTGGGTTTGGTGG + Intronic
1057761691 9:97879723-97879745 ATTCATTAGGCTGGGTACAGTGG + Intergenic
1058672386 9:107370974-107370996 AATGATGAGGCTGGGCATGGTGG + Intergenic
1058886210 9:109323038-109323060 AATAATATGGCTGGGTGTGGTGG + Intergenic
1059078042 9:111215746-111215768 AAATAGAAGGCTGGGTATGGAGG - Intergenic
1059192150 9:112336159-112336181 AATTATGAGGCTGGGCATAGTGG - Intergenic
1059566597 9:115388555-115388577 TATAATAAGGCTGGGTGTGGTGG + Intronic
1060022272 9:120141964-120141986 AAGCAGAAGGCTGGGCATGGTGG + Intergenic
1060606580 9:124920110-124920132 AAAAATAAGGCTGGGTGTGGTGG - Intronic
1060639267 9:125225095-125225117 AATAATAAGACTGGGTGTGGTGG + Intronic
1060768264 9:126311204-126311226 AACCTGAAGGCTGGGTATGGTGG + Intergenic
1060948795 9:127587418-127587440 AAACATTAGGCTGGGTGTAGTGG - Intergenic
1060968837 9:127726498-127726520 AATCATAAGGCCAGGCATGGTGG + Intronic
1061375559 9:130222438-130222460 AAAAATAAGGCTGGGCATGGTGG - Intronic
1061464908 9:130770217-130770239 ATTTATAAGACTGGGTATGGTGG + Intronic
1185813174 X:3129368-3129390 AAGAATAAGGCTGGGAATTGAGG + Intergenic
1186241548 X:7573152-7573174 AATATCAAGGCTGGGTATGGTGG + Intergenic
1186299340 X:8182743-8182765 AAAGATAAGGCTGGGTGTGGTGG + Intergenic
1187158280 X:16741548-16741570 AATAATAAGTCTGGTTATTACGG + Intronic
1187353894 X:18548174-18548196 ATTGATAACGCTTGGTATTGAGG + Intronic
1187477389 X:19624115-19624137 AATCACAGGGCTGGGTGTAGTGG - Intronic
1187515158 X:19962795-19962817 AAGCTTAAGGCTGGGTATGGTGG + Intronic
1188080088 X:25828345-25828367 AAATATAAGGCTGGGTGTGGTGG - Intergenic
1189400962 X:40668093-40668115 AATACTAAGGCTGGGTGTGGTGG + Intronic
1189888455 X:45574418-45574440 ACTCATAAGGCTGGGGATAGCGG - Intergenic
1190043725 X:47094582-47094604 AATAATAAGGTTGGGTGTGGTGG - Intergenic
1190156756 X:47999846-47999868 AATAATAAGGCTGGGCACAGTGG + Intronic
1190818158 X:53947288-53947310 TATAATAAGGCTGGGCATGGTGG - Intronic
1191910911 X:66148582-66148604 CACCATAAGGCTGGGGATGGTGG + Intergenic
1192003526 X:67183199-67183221 AATCTTTAGGCTGGGTGTGGTGG - Intergenic
1192006034 X:67213569-67213591 AATCACCAGGCTGGGTGTGGTGG + Intergenic
1192131179 X:68552601-68552623 CATCATCAGGCTGGGCATAGTGG + Intergenic
1192382391 X:70631797-70631819 AATCAGAAGACTGTGTGTTGTGG + Intronic
1192586888 X:72326229-72326251 AATAATATGGCTGGGTGTGGCGG - Intergenic
1192610639 X:72563261-72563283 TAGCATAAGGCTGGGCATGGTGG + Intronic
1192769205 X:74169484-74169506 GAACATAAGGCTGGGCATGGTGG - Intergenic
1193433560 X:81442462-81442484 AATCAGAAGGCCGGGCATGGTGG - Intergenic
1195051892 X:101104571-101104593 AAAGTTAAGGCTGGGTATAGTGG + Intronic
1195114408 X:101682651-101682673 AAACATAAGACTGGGTAGAGGGG - Intergenic
1195634284 X:107095723-107095745 ATTCAAAAGGCTGGGTGTGGTGG + Intronic
1195638997 X:107153678-107153700 AACCACAGGGCTGGGTATGGTGG + Intronic
1197219596 X:123898639-123898661 AAAGATAAGGCTGGGCATGGTGG - Intronic
1197234342 X:124042723-124042745 AAGCATTAGGCTGGGCATGGTGG + Intronic
1197981779 X:132224830-132224852 TATCATCAGGCTGGGTGTGGTGG - Intergenic
1198114304 X:133530322-133530344 AAGCATAGGGCTGGGCATGGTGG - Intergenic
1201268429 Y:12231174-12231196 AAGAATAAGGCTGGGAATTGAGG - Intergenic