ID: 1158144623

View in Genome Browser
Species Human (GRCh38)
Location 18:54298325-54298347
Sequence CCTGATGTCCAGACAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 294}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158144623_1158144628 8 Left 1158144623 18:54298325-54298347 CCCTCCTCTGTCTGGACATCAGG 0: 1
1: 0
2: 0
3: 25
4: 294
Right 1158144628 18:54298356-54298378 AAGTCTCAACACCCTAATCATGG 0: 1
1: 0
2: 0
3: 11
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158144623 Original CRISPR CCTGATGTCCAGACAGAGGA GGG (reversed) Intronic
900507760 1:3038254-3038276 ACTGATGTGCAGACGGAGGTAGG - Intergenic
901036094 1:6337135-6337157 CCTGATGTCCCCAGGGAGGAGGG + Intronic
902163231 1:14549472-14549494 CCTGTGGCCCAGACACAGGATGG + Intergenic
902293030 1:15447393-15447415 ACTGAGGCCCAGAGAGAGGAAGG + Intronic
903368794 1:22821483-22821505 CCTGAAGCCCAAAGAGAGGAAGG + Intronic
903648443 1:24908881-24908903 CCTGAGGCCCAGAGAGAAGAAGG - Intronic
903658048 1:24960803-24960825 ACTGAGGCCCAGAGAGAGGAAGG + Intronic
904535079 1:31194103-31194125 CCTGATCTCCCGCCAGGGGAAGG + Intronic
904851541 1:33463245-33463267 ACTGAGGCCCAGACAGAAGAAGG - Intergenic
905242912 1:36592701-36592723 ACGGAGGTCCAGACAGAAGATGG + Intergenic
905250253 1:36643800-36643822 CCTGAGTCCCAGACATAGGAGGG + Intergenic
905915069 1:41678904-41678926 CCAGATGTCCAGGGAGAAGAAGG + Intronic
905947921 1:41919316-41919338 CCTGATCTGCAGCCAGAGGCTGG - Intronic
906692481 1:47801686-47801708 TCTGAAGTCCAGAGGGAGGAGGG - Intronic
906824981 1:48969665-48969687 CCTCATGTCCCAACAAAGGAAGG - Intronic
907515415 1:54990559-54990581 CCTGCTGTCTAGACCGAGGAGGG - Intronic
907823190 1:57990635-57990657 CCAGAGGTCCAGACTGAGGACGG + Intronic
908662085 1:66447726-66447748 CCTGAATTCCAAAGAGAGGAGGG - Intergenic
909118857 1:71575117-71575139 GCTGATCTACAGAGAGAGGAAGG + Intronic
909673272 1:78212143-78212165 GCTAATGTCCATACAGAGGTTGG + Intergenic
912530125 1:110314542-110314564 CCTGGAGCCCAGACGGAGGATGG + Intergenic
914258881 1:145982397-145982419 TGTCATGTCCAGCCAGAGGATGG + Intergenic
915201236 1:154230885-154230907 ACAGATGTGCATACAGAGGAGGG + Intronic
915489336 1:156242668-156242690 CCTGATGGCCAGACAGGAGGTGG - Intronic
915916403 1:159943410-159943432 GCTGATGACCAGGCTGAGGACGG + Exonic
916059442 1:161088735-161088757 CCTGATGCCCAGAGAGTGGATGG - Intronic
917445060 1:175099882-175099904 CCTGATGTATTGGCAGAGGAAGG - Intronic
917605699 1:176626758-176626780 CTTGATGTCCAGACAGCACAAGG + Intronic
917675491 1:177315193-177315215 CCAAATGTCCAGAGAGATGAAGG + Intergenic
920359889 1:205407374-205407396 CCTGACCTCCAGGTAGAGGAGGG + Intronic
921405016 1:214769204-214769226 ACTGATGACCAGAAACAGGAGGG - Intergenic
922273230 1:224053624-224053646 CCTGATGTACAGCCCCAGGAAGG + Intergenic
922969936 1:229727754-229727776 CCAGGTGACCAGACGGAGGAGGG + Intergenic
923473733 1:234314050-234314072 GCTGATGTCCAGAGAGTGGAAGG + Intronic
1062910700 10:1209818-1209840 CCAGAAGCCCACACAGAGGACGG + Intronic
1064294528 10:14066329-14066351 CCTGTTGTCCACACAGGGAAGGG + Intronic
1067477485 10:46576493-46576515 ACTGAACTCTAGACAGAGGAAGG + Intergenic
1067497791 10:46774986-46775008 CTTGATGTCCAGAGAGAAGGAGG + Intergenic
1067596858 10:47565428-47565450 CTTGATGTCCAGAGAGAAGGAGG - Intergenic
1067617255 10:47765291-47765313 ACTGAACTCTAGACAGAGGAAGG - Intergenic
1068968643 10:62939337-62939359 CCAAAAATCCAGACAGAGGATGG - Intergenic
1069799306 10:71072390-71072412 GCTGCTGTCCAGACAGTGGAAGG + Intergenic
1072536086 10:96364252-96364274 ACAAATGTCCAGATAGAGGAGGG + Intergenic
1073452440 10:103617811-103617833 TCTGAAGGTCAGACAGAGGAAGG - Intronic
1073541624 10:104319869-104319891 CCTGAATTCCAGAGGGAGGAGGG - Intronic
1075017280 10:118919255-118919277 AGTGATGCCCAGATAGAGGAGGG + Intergenic
1075173818 10:120141011-120141033 CCTGGGGTCCAGAAAGAGAAGGG - Intergenic
1075984659 10:126774241-126774263 CCTGATGGCCCCACAGAGGTGGG - Intergenic
1076052184 10:127344364-127344386 CCGGGTGTCCAAACAGGGGAAGG - Intronic
1076256727 10:129032505-129032527 TCTGGTGTCTACACAGAGGAGGG + Intergenic
1076408874 10:130231777-130231799 CCTGATGTATACACAGGGGACGG + Intergenic
1076742905 10:132496837-132496859 ACAGGTGTCCAGACAGAGGAAGG - Intergenic
1077289795 11:1783717-1783739 CCTGCCCTCCAGGCAGAGGAGGG + Intergenic
1077329613 11:1978277-1978299 CTTGAGGTGCAGAGAGAGGATGG + Intronic
1078442997 11:11383049-11383071 CCTGATCTCCTGACATTGGAGGG + Intronic
1079471105 11:20778376-20778398 CCTGATGTATAGAGTGAGGATGG - Intronic
1081734868 11:45395556-45395578 ACTGATGTCCAGACAGTGCTGGG - Intergenic
1081749739 11:45501519-45501541 CCCTTTGTCCAGACAGAGGGAGG + Intergenic
1084037760 11:66523373-66523395 CATGAGGTTTAGACAGAGGAGGG + Intronic
1085501788 11:77031002-77031024 CCTGGTGTCCAGCCAGAGTGAGG + Intergenic
1085758199 11:79219062-79219084 CCTAATGTGTGGACAGAGGATGG + Intronic
1087151526 11:94864537-94864559 TCTGATGCCCATACAGAGAAAGG - Intronic
1087460016 11:98434129-98434151 ACTGATGTCCATATAAAGGAAGG - Intergenic
1087994013 11:104781202-104781224 CCTGAATTCCAGAGAGAGAAGGG + Intergenic
1088930699 11:114348358-114348380 CCTGAAGTCTGGGCAGAGGAAGG - Intergenic
1202812592 11_KI270721v1_random:33456-33478 CTTGAGGTGCAGAGAGAGGATGG + Intergenic
1091882236 12:3989344-3989366 TCTCCTGACCAGACAGAGGAAGG + Intergenic
1092104904 12:5914467-5914489 CCTGATACCGAGACAGAGTAGGG + Intronic
1092138679 12:6167691-6167713 CCTGATGTCTACACTGGGGATGG - Intergenic
1093022967 12:14219929-14219951 CCTGATGTCTGGGCAGAGGAAGG + Intergenic
1096515688 12:52153944-52153966 ACTGAGGTCCAGAGAGAGGAAGG - Intergenic
1100441056 12:94617228-94617250 CCTGATGAACAGAGAGAGAAAGG + Intronic
1102431689 12:112889055-112889077 CCAGATGGCCAGCCTGAGGATGG + Intronic
1103200987 12:119087797-119087819 CCTGGTCTCCAGACTGAGCATGG - Intronic
1103721549 12:122978169-122978191 CCTGAGGCCCAGAGAGGGGAAGG - Intronic
1103838005 12:123839377-123839399 ACTGATGTCCAGAGAGATCAAGG - Intronic
1106409118 13:29498854-29498876 CCTGATGCCCAGACACTGCACGG + Intronic
1107428316 13:40316330-40316352 CATGATGGCAAGACAGAGGTGGG - Intergenic
1108215225 13:48177183-48177205 CCTCATGTCCAGAGGGAAGACGG + Intergenic
1108955793 13:56155764-56155786 CAGGATGTCCACACAGAGAAGGG + Intergenic
1110325166 13:74205650-74205672 CCTGACGTAGACACAGAGGAAGG + Intergenic
1113272761 13:108692853-108692875 GCTGATGTCCACACTGTGGATGG + Intronic
1113671428 13:112178171-112178193 CCTGATATTCAGCCATAGGATGG - Intergenic
1113770166 13:112903158-112903180 CGTCCTGTCCAGCCAGAGGATGG - Intronic
1117343635 14:54812310-54812332 ACTGATGACCAGTCAGAGCATGG - Intergenic
1118491567 14:66265953-66265975 CCTGAATTCCAAAGAGAGGAGGG + Intergenic
1118609299 14:67527716-67527738 CCTTATCTCCAGGCTGAGGATGG + Intronic
1118937904 14:70304902-70304924 CCTGTTGTACAGTCAGGGGATGG - Intergenic
1120625806 14:86824710-86824732 CCTGATTTTCAGAAAGATGAAGG + Intergenic
1120829963 14:88989257-88989279 CTTGATATCCAGAGAGAGAAGGG + Intergenic
1121371878 14:93366403-93366425 GATGATGTCCAGCCAGAGCAGGG + Intronic
1122067172 14:99181807-99181829 CCTGAAGTCCAGAGTGGGGAAGG - Intronic
1122092770 14:99350962-99350984 CCCTCTGTCCAGACAGGGGAGGG - Intergenic
1122149765 14:99718568-99718590 TCTGATGGCAAGACAAAGGAGGG + Intronic
1124516010 15:30367928-30367950 CCAGCTGTCCAGCCTGAGGAAGG + Intronic
1124726910 15:32162803-32162825 CCAGCTGTCCAGCCTGAGGAAGG - Intronic
1125038396 15:35154009-35154031 CTAGATCTCCAGAGAGAGGAAGG + Intergenic
1126143518 15:45456245-45456267 GATGGTGTCCAGACAGAGGGAGG - Intergenic
1127221959 15:56889220-56889242 CCTGAAGTAGAGACAGAGGAAGG - Intronic
1127916082 15:63456478-63456500 CCTGAGGCCCAGAAAGAGGAAGG - Intergenic
1128161677 15:65426797-65426819 ACTGAGGCCCAGAGAGAGGATGG - Intergenic
1129250558 15:74306611-74306633 ACTGAGGTCCAGACAGGGAAGGG - Intronic
1129467697 15:75733103-75733125 GCTGATGCCCAGAGAAAGGAGGG + Intergenic
1131266017 15:90915891-90915913 CATGAGGTCCAGAAAGGGGAAGG - Intronic
1131364315 15:91825277-91825299 CTTGAAGTCTAGAGAGAGGAAGG - Intergenic
1131367118 15:91851131-91851153 CCTCATGTACAGACTGAGAAGGG - Intergenic
1132010034 15:98267601-98267623 CCTGTTGTCCTGACTTAGGAAGG - Intergenic
1132330338 15:101008298-101008320 CCTGAGATACAGACAGACGATGG - Intronic
1133317015 16:4891179-4891201 CCTCATGACCAGACAGTGGCAGG - Intronic
1134827291 16:17294823-17294845 CCTGGTGTCCAGACAGTGCATGG + Intronic
1135166325 16:20142190-20142212 CCTGACTGCCAGACTGAGGAAGG + Intergenic
1135693194 16:24562057-24562079 ACGGATTTCCAGACACAGGAGGG - Exonic
1136448339 16:30337573-30337595 CCTGAGACCCAGAAAGAGGAAGG - Intergenic
1136690953 16:32028641-32028663 CTGGATGTCCAGAGAGAAGATGG - Intergenic
1136791540 16:32972203-32972225 CTGGATGTCCAGACAGAAGGTGG - Intergenic
1136878274 16:33881729-33881751 CTGGATGTCCAGACAGAAGGTGG + Intergenic
1137021619 16:35433314-35433336 ACTGAGGTCCAGAAAGAGGAAGG - Intergenic
1138596571 16:58032403-58032425 CTTGCTGTCCAGAGAGAGAATGG + Intronic
1139332434 16:66203812-66203834 TCTGAACTCCAGACAGAGGCAGG + Intergenic
1141685904 16:85569893-85569915 CCTCATCTCCACACAGAGGTGGG - Intergenic
1142047534 16:87935258-87935280 CCTGAGACCCAGAAAGAGGAAGG + Intronic
1142307121 16:89292023-89292045 CCTGATTTCCATCCACAGGAGGG - Intronic
1142407082 16:89896216-89896238 CCTTAAGCCCAGAGAGAGGAAGG - Intronic
1203093749 16_KI270728v1_random:1233664-1233686 CTGGATGTCCAGACAGAAGGTGG - Intergenic
1145233255 17:21190459-21190481 CAGGATGGCCAGACAGAGGTGGG - Intronic
1146510878 17:33447238-33447260 CCTGATGGCCAGAAAGATTAAGG + Intronic
1146632947 17:34483852-34483874 CCAGAGGTCCAGAGAGAGAACGG - Intergenic
1147832429 17:43306189-43306211 ACTGAGGTCCAGACAGATTAGGG - Intergenic
1148732658 17:49846940-49846962 ACTGATGTCCAGAAAGAAGCAGG + Intronic
1149301980 17:55313776-55313798 CCTGAGGTGCTGGCAGAGGATGG - Intronic
1149470993 17:56914916-56914938 CCTGCAGTCAAGCCAGAGGAGGG - Intergenic
1150129314 17:62658475-62658497 ACTGAAGTCCAGAAAGGGGACGG - Intronic
1150805052 17:68312169-68312191 CCTGAAGTCCAGAGCTAGGAGGG - Intronic
1151340330 17:73466874-73466896 ACTGAGGTCCAGAGAGGGGAAGG + Intronic
1151387012 17:73761149-73761171 CCTTAAGTCCAGTCACAGGAGGG + Intergenic
1152390407 17:80000899-80000921 CATGATGTCTAGGCAGAGAAGGG - Intronic
1152430414 17:80245766-80245788 CCTGTTGTCCTGACTGAGGAGGG - Intronic
1152801188 17:82331345-82331367 CCTGCTGCCCAGACAGAGCTGGG - Intronic
1152922401 17:83072643-83072665 CCCGCTGTCCAGACCCAGGATGG - Intergenic
1154999759 18:21674844-21674866 CCTGATAGCCAGAGGGAGGAGGG - Intronic
1156059219 18:33053162-33053184 GCTGATGTCCAGACACCAGATGG - Intronic
1157163019 18:45331934-45331956 CCTGCTGTCTGCACAGAGGAAGG - Intronic
1158144623 18:54298325-54298347 CCTGATGTCCAGACAGAGGAGGG - Intronic
1158937357 18:62376737-62376759 CCAGAAGTTCAGAGAGAGGAAGG - Intronic
1158957041 18:62550134-62550156 CCTGAGGTTCAGTCAGAAGATGG + Intronic
1160007811 18:75081064-75081086 GCTGATGCCCCGACAGAGGTGGG + Intergenic
1160543740 18:79639303-79639325 CCTGAATTCCAGAGGGAGGAGGG - Intergenic
1160569491 18:79807148-79807170 CCTGAGGTGCAGACAGATGCAGG - Intergenic
1160970484 19:1765738-1765760 CCTGATGTCCAGAGAGGCCAGGG + Intronic
1163267383 19:16229153-16229175 CCTGAGGTGAAGACAGAGGCTGG - Intronic
1166101204 19:40572398-40572420 ACTGAGGTCCACACAGAGGGAGG - Intronic
1166359402 19:42246604-42246626 CCTGAGGCCCAGAAAGGGGAAGG - Intronic
1166976597 19:46608516-46608538 CATGATGGCCAGAAAGATGAAGG + Exonic
1167711744 19:51115856-51115878 CCTGGGGACCAGACTGAGGAGGG + Intergenic
1168132824 19:54332050-54332072 ACTGAGGCCCAGGCAGAGGAGGG + Intergenic
1168318020 19:55492563-55492585 CCTCATCTGCAGACAGGGGAGGG - Intronic
1168595864 19:57676236-57676258 CCTGCTGTTCAGAGAGAAGAAGG + Exonic
925362500 2:3289319-3289341 CTCTCTGTCCAGACAGAGGATGG + Intronic
927596226 2:24400480-24400502 CCTGACTTCCAGGCAGGGGAGGG - Intergenic
927881773 2:26694159-26694181 CCTGAGACCCAGACAGGGGAAGG - Intronic
928478453 2:31655444-31655466 ACTGACTTCCAGGCAGAGGATGG + Intergenic
929527990 2:42724085-42724107 CCTGATGTCTAGACAGCAGAAGG + Intronic
934537246 2:95145282-95145304 CCTGAATTCCAAAGAGAGGAAGG - Intronic
934675466 2:96246709-96246731 CCTGTGGTCCAGGTAGAGGATGG - Intergenic
934897962 2:98134902-98134924 CTTGGTGTCCAAGCAGAGGAGGG + Intronic
935410796 2:102759836-102759858 GCTGGTTTCAAGACAGAGGAAGG - Intronic
935457988 2:103292802-103292824 TCTAATTTCCAGACAGGGGATGG + Intergenic
935480920 2:103588384-103588406 GCTGATGTCCAAATAGAGCAAGG - Intergenic
935861834 2:107339578-107339600 CCTGATGTCCTGTAAGAAGAAGG + Intergenic
938197920 2:129347671-129347693 CGTGAAGTGCAGACAGAAGAGGG - Intergenic
938661810 2:133494635-133494657 CCCGATTTCCATAGAGAGGAGGG - Intronic
939098578 2:137866786-137866808 CCTGATGTCCAAGAGGAGGAAGG - Intergenic
940136974 2:150447990-150448012 CCTGACCTCCAGAAAGAGGAGGG - Intergenic
940154754 2:150643714-150643736 TTTGATGACAAGACAGAGGAAGG - Intergenic
941435747 2:165469247-165469269 TTTGATATGCAGACAGAGGAGGG - Intergenic
941885831 2:170526178-170526200 ACTGAGGTTCAGAGAGAGGAAGG - Intronic
943483737 2:188454600-188454622 CCTGATCTACTGACAGAGGCAGG - Intronic
946063419 2:216965803-216965825 CCTGATGATCTCACAGAGGAGGG - Intergenic
946269361 2:218577607-218577629 CCTGATGCCCACAGAGAAGATGG - Intronic
947330532 2:229025113-229025135 GCTGATTTGCATACAGAGGAGGG + Exonic
948705447 2:239789493-239789515 CTTGATGTCCAGCACGAGGATGG + Intronic
948823815 2:240564672-240564694 CCTGATGTCCTGGCTGTGGAGGG + Intronic
1168977100 20:1974934-1974956 CTTCAAGTCCAGACAGAGCATGG + Intergenic
1170723923 20:18908794-18908816 CTTTCTATCCAGACAGAGGAAGG - Intergenic
1171981758 20:31633536-31633558 CCTGATGTTCCCACAGAGGCGGG + Intergenic
1173215441 20:41077665-41077687 CCTGCTGTCCACCCAGAGAAAGG - Intronic
1173236445 20:41250110-41250132 CCTGATATCTAGGTAGAGGAGGG - Intronic
1173978830 20:47207502-47207524 CCTGAAGACCAGAGAAAGGAGGG - Intergenic
1174045009 20:47727228-47727250 ACTGGTGTCCTGACAGAAGAGGG + Intronic
1174765207 20:53247103-53247125 TCTGACTTTCAGACAGAGGAGGG + Intronic
1175374568 20:58515331-58515353 CCTCATTTACAGACAGAGGCCGG - Intergenic
1175535484 20:59708116-59708138 CCAGCTGTACAGACAGAGGTAGG - Intronic
1177035075 21:16032932-16032954 CCTGGAGTCCAGAGACAGGAAGG + Intergenic
1182567489 22:31211146-31211168 CCAAATGACCAGAAAGAGGATGG - Intergenic
1182680472 22:32075454-32075476 ACTGAGGTCCAGACAGGGGAAGG + Intronic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1182891167 22:33819958-33819980 ACTGATGTCCAGCCAGCAGAGGG - Intronic
1183008152 22:34920720-34920742 ACTGATGTCCAGCCAGCAGACGG - Intergenic
1183714742 22:39527063-39527085 CATGATGTCTAGACTGAGGGAGG + Intergenic
1184800941 22:46758885-46758907 TCTGCTTTCCAGACAGAGGAAGG + Intergenic
1185156539 22:49196479-49196501 CCTGATGGCTCCACAGAGGAGGG + Intergenic
949415911 3:3814005-3814027 CTAGATGTGCAGACAGGGGAGGG - Intronic
950048263 3:9964705-9964727 CCTTATGTCCAGACACACAATGG + Intronic
951221150 3:20070060-20070082 CCTGATGCCTAGACAAAAGACGG + Intronic
952052246 3:29398394-29398416 CCTGATGACCAGAGAGAAAAAGG - Intronic
952730239 3:36630900-36630922 GCTGAAGTCCAGAGAGAAGATGG - Intergenic
953866399 3:46586887-46586909 CCTGAGGACCAGATAGAGGAAGG + Intronic
954647017 3:52137827-52137849 CCTGATGTCAACTCAGAGCATGG + Intronic
954891808 3:53937417-53937439 CCAGATCTCCAGGCAGGGGAAGG + Intergenic
955428086 3:58813329-58813351 GCTGATGTTCAAAAAGAGGATGG - Intronic
955971387 3:64442025-64442047 TTTGAAGTCCAGACAGAGCAGGG - Intronic
956746829 3:72317185-72317207 CCTGAGGTCCTGTCAGAGGGTGG - Intergenic
957165055 3:76662062-76662084 CCTGAATTCCAAAGAGAGGAGGG + Intronic
957884307 3:86264828-86264850 CCTGATGTAAACATAGAGGAAGG + Intergenic
959800235 3:110485640-110485662 CCTGATCTCCAGCCTGAAGAAGG - Intergenic
960357358 3:116670067-116670089 CCTGACCTCCAGGCAGAGGAAGG + Intronic
961432901 3:126895852-126895874 CCTGATTGCCACACAGAAGATGG + Intronic
961648204 3:128403877-128403899 CCAGATCTCCAGACAGCAGAAGG - Intronic
962636634 3:137338571-137338593 CTTGATGTCCAGGCAGAAGTTGG + Intergenic
964850182 3:161087701-161087723 CCTGATCTCAAGGCAGAGGGTGG + Intronic
966752999 3:183340462-183340484 TCTGAGGTCCCTACAGAGGAAGG + Intronic
967814465 3:193787435-193787457 CCTGCTCTGCAGACAGAGGGAGG + Intergenic
970371662 4:15413198-15413220 CATGATGTGAACACAGAGGATGG - Intronic
971413485 4:26400254-26400276 CCAAATGTCAAGAAAGAGGATGG - Intronic
972322870 4:37988862-37988884 CCTGAATTCCAGAGAGAGGAAGG - Intronic
974620344 4:64346400-64346422 CCGGATGTCTAGACAGAAGTCGG - Intronic
974669856 4:65015367-65015389 CCTGATTTCCAAAGGGAGGAAGG + Intergenic
979461955 4:120994056-120994078 CCTGATCTCTAGAGAAAGGAAGG - Intergenic
980416892 4:132501044-132501066 CCTGAAGTCCAGTCAGGGGCGGG - Intergenic
982274047 4:153621828-153621850 CCTGCTGCCCAGAGAGAGGCAGG + Exonic
982518777 4:156386868-156386890 CCTGCTGTTGAGATAGAGGAAGG - Intergenic
983008850 4:162520159-162520181 ACAGATGTCCAAACAGAGAAAGG - Intergenic
983523572 4:168736671-168736693 CCTGATGTTCAGATGGTGGATGG - Intronic
983557099 4:169068535-169068557 CCTGATTTCCCCACACAGGAAGG - Intergenic
984877698 4:184384521-184384543 CCTGCTGTGCAGACAAATGAGGG - Intergenic
985955002 5:3258134-3258156 CCTTCTGTCCAGGCAGACGAAGG + Intergenic
985965868 5:3338472-3338494 CGTGGGGTCCAGACAGAGGTGGG - Intergenic
986376651 5:7138949-7138971 CCTGATGACCACAGAGAGGCTGG - Intergenic
990990001 5:61675229-61675251 CCTGGTGGCCAGACAAAGAAAGG - Intronic
991446035 5:66700738-66700760 CCTCATTTCCATACAGAGAAAGG - Intronic
992110480 5:73488014-73488036 CCTGAATTCCAGAGAGAGTAAGG + Intergenic
993325510 5:86530549-86530571 ACTGAGGTCCAGATAGATGAAGG - Intergenic
995281417 5:110339918-110339940 CCTGAACTCCAAAAAGAGGAGGG + Intronic
996708774 5:126523403-126523425 TCTGATGCACAGAGAGAGGATGG - Intergenic
999065615 5:148682741-148682763 CCTGCTGCACAGACATAGGAAGG + Intergenic
1001253754 5:170168124-170168146 ACTGAAGCCCAGAGAGAGGAAGG - Intergenic
1001724503 5:173885726-173885748 CCTTATGTGTAGACAGAGGGAGG + Intergenic
1002505950 5:179679226-179679248 CCGGATGTCCAGAATGATGAAGG + Exonic
1003679224 6:8235597-8235619 CCTGAGGTACAGACAGAGCAGGG + Intergenic
1006606479 6:35260700-35260722 ACTGAGGTCCAGACTGAGGAGGG - Intronic
1006812323 6:36827902-36827924 GCTGCTGTGCAGACAGCGGAAGG - Intronic
1006914633 6:37586306-37586328 CCTGATGACCAGACTGATGCTGG + Intergenic
1007662751 6:43496579-43496601 CAGGCTGTCCAGACAGAGGAGGG + Intronic
1009546017 6:65020754-65020776 CTGGATGTCCAGGCAGAGGTGGG - Intronic
1011722701 6:90175839-90175861 TCTGAGGGCCAGATAGAGGAGGG - Intronic
1013088515 6:106876987-106877009 AGTGAAGTCCAGACTGAGGAGGG - Intergenic
1015159709 6:130138949-130138971 GAAGATGTCCAGAGAGAGGAAGG + Intronic
1016298370 6:142600977-142600999 CCTGAAGTTCAGGTAGAGGAAGG - Intergenic
1017620548 6:156292177-156292199 CCTTGTGAGCAGACAGAGGAAGG + Intergenic
1018126586 6:160689066-160689088 ACTGCTGGCCAGACAGAGAAGGG + Intergenic
1019300475 7:300617-300639 GCTTGTTTCCAGACAGAGGAGGG + Intergenic
1019563652 7:1669647-1669669 CCTGAAGTCCTCACAGAGGTTGG + Intergenic
1020756881 7:12213945-12213967 CCTGAATTCCAAAGAGAGGAAGG - Intronic
1024034511 7:45495806-45495828 CCTGAATTCCAGAGGGAGGAGGG + Intergenic
1024971620 7:55076947-55076969 TCTAATGTCCAAGCAGAGGATGG - Intronic
1026522521 7:71129951-71129973 CATGAACTCCAGAAAGAGGAGGG + Intergenic
1028478699 7:91280369-91280391 CTTGATGTGCAGGCAGAGGAGGG + Intergenic
1029609070 7:101617025-101617047 ACTGAAGCCCAGAGAGAGGAAGG + Intronic
1031008615 7:116500426-116500448 CCAGATGTGCAGACAGCTGAGGG - Exonic
1031788032 7:126059087-126059109 CCAGATATCCAGACAGAAGGGGG + Intergenic
1033600188 7:142883788-142883810 CCTGATATCCAGCAAGAAGAAGG + Intronic
1036434583 8:8722031-8722053 ACTGAAGTCCAGAGAGAGGAAGG - Intergenic
1036640789 8:10582354-10582376 CCTGACGTCCAAGGAGAGGAGGG - Intergenic
1036685544 8:10907246-10907268 CTTTTTGTCCAGCCAGAGGATGG - Intronic
1037884047 8:22586985-22587007 CCTGAGGCCCAGGGAGAGGAAGG - Intronic
1037905657 8:22714665-22714687 TCTGATACCCAGACAGAAGAGGG + Intronic
1038711368 8:29949994-29950016 CCTGCTGCACAGGCAGAGGATGG + Intergenic
1039411662 8:37360078-37360100 ACTGAGGTCCAGAGAGGGGAAGG - Intergenic
1039776863 8:40745708-40745730 CCCCATTTCCAGCCAGAGGATGG + Intronic
1041755481 8:61308840-61308862 CCTTATGTGCAGACAGACTAGGG - Intronic
1043779912 8:84319511-84319533 TGTGATATTCAGACAGAGGAAGG + Intronic
1043876275 8:85490403-85490425 CCTAAAGTCAAGACAAAGGAAGG - Intergenic
1045646617 8:104305632-104305654 GCTGATGTCCAGACCAGGGATGG + Intergenic
1046121668 8:109855344-109855366 CCTGAACTCCAAAGAGAGGAGGG - Intergenic
1046450422 8:114383331-114383353 ACTGAGGCCCAGAAAGAGGAAGG + Intergenic
1047436511 8:124839429-124839451 CCTGAAGGCCAGACAGGGTAAGG + Intergenic
1047807957 8:128379006-128379028 CCTGACATCTAGGCAGAGGAAGG - Intergenic
1048162316 8:132032612-132032634 CCTGTTGGGCATACAGAGGAGGG - Intronic
1048429904 8:134360470-134360492 TCTGATCTCCAGACAGACAAGGG + Intergenic
1049277158 8:141725611-141725633 CCTGCAGGCCAGGCAGAGGAAGG + Intergenic
1049435553 8:142584626-142584648 CCTGAAGTCCACAGAGGGGATGG + Intergenic
1050480461 9:6082303-6082325 CCTGATGTCTGGTCAAAGGAAGG + Intergenic
1051682633 9:19623286-19623308 CCAGAAGGCCAGACAGGGGAAGG - Intronic
1053307206 9:36993532-36993554 ACTGAGGCCCAGACAGAGAAAGG + Intronic
1053451988 9:38201359-38201381 ACTGAGGCCCAGACACAGGAAGG + Intergenic
1054732429 9:68714732-68714754 CCTGGAGTCCAGTCAGAGGCAGG + Intronic
1058120732 9:101135837-101135859 CCTGCTGGGCAGACAGAGGCAGG - Intronic
1061407828 9:130402559-130402581 ACTGAGGTCCAGAGAGTGGAAGG + Intronic
1061499451 9:130993642-130993664 CCTGAGGCCCAGAGAGGGGAAGG + Intergenic
1061596281 9:131631504-131631526 CCAGATGTCCAGCAACAGGAAGG - Intronic
1061632216 9:131879563-131879585 CCAGATGTCCTGACAGTGGTGGG - Intronic
1061770821 9:132919927-132919949 TCTGCTGATCAGACAGAGGAGGG - Intronic
1061871731 9:133524518-133524540 ACTGAGGTCCAGATAGGGGAAGG + Intronic
1188260343 X:28016148-28016170 TATGAGGTCCAGACAGAGGCTGG + Intergenic
1189131486 X:38502639-38502661 CCTGATGCTCAGAGAGAGGGTGG + Intronic
1189705550 X:43755780-43755802 CCTGAAACCCAGACTGAGGATGG - Intergenic
1190399233 X:50014909-50014931 CCTGCTGTCCACACACAGGGTGG + Intronic
1191263676 X:58359064-58359086 CCTAATGTCCATTCAGAGAATGG - Intergenic
1191842715 X:65524584-65524606 ACTGAGGTCCAGAGAGGGGAAGG - Exonic
1192005602 X:67208750-67208772 AATGAGGTCCAGAAAGAGGAAGG - Intergenic
1194642362 X:96417627-96417649 CCTGGTGTCCAGACTGTAGATGG + Intergenic
1195029789 X:100915155-100915177 CCAGAGGTCCAGAGAGATGACGG + Intronic
1195431276 X:104792137-104792159 ACTGAGGTTCAGAAAGAGGAAGG + Intronic
1195745189 X:108110285-108110307 CCTTAAGCCCAGAAAGAGGAGGG + Intronic
1195898974 X:109777859-109777881 CCAGAGATCCAGACAGAGCATGG + Intergenic
1196890519 X:120286715-120286737 CCTGAGTTCCACACATAGGATGG - Intronic
1199092541 X:143708703-143708725 CCGGATGTCCAGCCAGAAGTCGG - Intergenic
1199880767 X:151973081-151973103 ACTGAGGCCCAGATAGAGGAAGG + Intronic
1200078992 X:153566287-153566309 CCTGAGGTCCTGCCAGAGTAAGG + Intronic
1200244850 X:154517432-154517454 GCTGCTCTCCAGACAGATGATGG - Intergenic