ID: 1158149787

View in Genome Browser
Species Human (GRCh38)
Location 18:54355530-54355552
Sequence CAGTGTCCTCACATGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4769
Summary {0: 2, 1: 14, 2: 383, 3: 1258, 4: 3112}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158149787_1158149791 9 Left 1158149787 18:54355530-54355552 CCTTCTTCCATGTGAGGACACTG 0: 2
1: 14
2: 383
3: 1258
4: 3112
Right 1158149791 18:54355562-54355584 AGCAGTCTGCAACCAGAAGAGGG 0: 1
1: 2
2: 9
3: 29
4: 239
1158149787_1158149790 8 Left 1158149787 18:54355530-54355552 CCTTCTTCCATGTGAGGACACTG 0: 2
1: 14
2: 383
3: 1258
4: 3112
Right 1158149790 18:54355561-54355583 TAGCAGTCTGCAACCAGAAGAGG 0: 1
1: 2
2: 4
3: 25
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158149787 Original CRISPR CAGTGTCCTCACATGGAAGA AGG (reversed) Intronic
Too many off-targets to display for this crispr