ID: 1158149987

View in Genome Browser
Species Human (GRCh38)
Location 18:54357534-54357556
Sequence CTGAACTCACTTGGAAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 304}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158149987 Original CRISPR CTGAACTCACTTGGAAAAAC TGG Intronic
901776027 1:11560970-11560992 CTGCTCTCACCTGGAAAATCCGG - Intergenic
905107508 1:35573348-35573370 CTGATCGCACTTGGAAAAGTCGG - Exonic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
908049649 1:60214921-60214943 CTGACCCAACTTGGCAAAACAGG - Intergenic
910022962 1:82615306-82615328 CTGCTCTCACATGGAAACACTGG + Intergenic
911262700 1:95705673-95705695 ATAAACTTTCTTGGAAAAACAGG - Intergenic
911485016 1:98494513-98494535 TTCAACTCACTTGAAAAAACTGG + Intergenic
915526160 1:156477462-156477484 CTGAAGTCAGTGGGAAGAACTGG + Intronic
915620693 1:157081712-157081734 CTGAAATCATTTGGCAATACAGG - Intergenic
915665792 1:157443322-157443344 CAGGACACAATTGGAAAAACGGG - Intergenic
917991877 1:180388324-180388346 CTGAACTGAATAGGAAGAACAGG + Intronic
918373729 1:183887509-183887531 GTGTACTCACTTGTAAACACTGG + Intronic
918589662 1:186226683-186226705 CAGGACACAATTGGAAAAACTGG + Intergenic
919483144 1:198113883-198113905 CTGGACTCAGCTGGGAAAACTGG + Intergenic
920786420 1:209046461-209046483 CTGAAAACACTTGCAGAAACAGG - Intergenic
921146699 1:212365108-212365130 CTGTACTCACTTGAAGAAATGGG - Exonic
921569981 1:216766124-216766146 GTGCACTCACATGGAAAAACTGG + Intronic
922550750 1:226492409-226492431 CAGGACACAATTGGAAAAACTGG - Intergenic
922875273 1:228935542-228935564 GCGAACTCACTTGCAAAGACAGG + Intergenic
923914133 1:238483401-238483423 CAGAAAACAATTGGAAAAACTGG - Intergenic
924740208 1:246790433-246790455 CTGACCTCACCTGGAAAACAAGG - Intergenic
1063332165 10:5170782-5170804 CAGGACACAATTGGAAAAACTGG - Intergenic
1063532823 10:6852161-6852183 CAGAACTCACATGGAAAGAGAGG - Intergenic
1064147649 10:12838167-12838189 CTGAAGCCACTTGGATAATCAGG - Intergenic
1065191230 10:23210954-23210976 CTGAACTCATTTGGAATAGTGGG + Intronic
1065253703 10:23843463-23843485 CTGAAAACACTTGGGAGAACAGG - Intronic
1065928734 10:30459577-30459599 ATGAAAGCACTTGGAAAAAAAGG + Intronic
1067326823 10:45276507-45276529 CAGAACACAATTGGAAAAACTGG - Intergenic
1067771363 10:49128770-49128792 CTGAGCTGACATGGAGAAACCGG - Intergenic
1067814346 10:49461136-49461158 CTGAAGCCACTTTGGAAAACAGG + Intronic
1068662308 10:59635292-59635314 CTGGACTCAGTGGGAACAACAGG + Intergenic
1068907342 10:62341449-62341471 CAGGACACAATTGGAAAAACTGG - Intergenic
1070344191 10:75525512-75525534 CTTAACTGACTTGGTAAGACTGG + Intronic
1071307293 10:84310697-84310719 CTGATCTCTGTTGGAAGAACTGG + Intergenic
1071926315 10:90414228-90414250 CAGAACGCAATTGGAAAAACTGG + Intergenic
1072044476 10:91640903-91640925 CTTAAGTCACTTAGTAAAACTGG + Intergenic
1076354786 10:129843692-129843714 CTGAACTCACTTGCAAATTTGGG - Intronic
1078377233 11:10806631-10806653 CTCAACTCACTTAGAAAATTTGG + Intronic
1078698449 11:13658472-13658494 CTGAGATCCCTGGGAAAAACAGG - Intergenic
1078827558 11:14944536-14944558 TAAAATTCACTTGGAAAAACAGG - Intronic
1078857568 11:15219231-15219253 CAGACCTCACTTGGAGAAACAGG + Intronic
1079618889 11:22528942-22528964 CTGAAGGCACCTGGAAAATCGGG - Intergenic
1080071446 11:28093232-28093254 CTGAACTCAATTGGGAAAAGAGG - Intronic
1080491566 11:32770149-32770171 CTGAACTCAGCTGGAAATGCTGG + Intronic
1082216766 11:49580236-49580258 ATGCACTCATTTGGAAAACCTGG - Intergenic
1083164313 11:60874281-60874303 CTGATTTCACTTGGAAGCACTGG + Intronic
1085644859 11:78216393-78216415 GTCAACTCAGTTGAAAAAACTGG - Exonic
1086262136 11:84952947-84952969 CTGAAAGCACTTTGAGAAACTGG - Intronic
1086391195 11:86365571-86365593 CTGAACTCACTTTTTAAGACTGG - Intergenic
1086632785 11:89043839-89043861 ATGCACTCATTTGGAAAACCTGG + Intronic
1087432074 11:98067295-98067317 CAGAACACAATTGGAGAAACTGG - Intergenic
1087524841 11:99296696-99296718 CTGGACTCCCTGGGAAAAACAGG - Intronic
1088634684 11:111808453-111808475 TTGAACTCACTCAGAACAACTGG + Intronic
1090100393 11:123789363-123789385 CAGGACACAGTTGGAAAAACTGG - Intergenic
1093630540 12:21403678-21403700 CTGTACTCACTTGGAACCAGAGG + Intronic
1093804394 12:23414349-23414371 TTGAACTAAATAGGAAAAACCGG + Intergenic
1094573056 12:31659087-31659109 CTGACCTCACCTGGAAAATAAGG - Intronic
1095572986 12:43703767-43703789 CAGGACACAATTGGAAAAACTGG + Intergenic
1095988664 12:48018133-48018155 CTCTACTTATTTGGAAAAACAGG - Intergenic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1098030910 12:66252723-66252745 CTGAACCCATTTGGAAGAGCTGG - Exonic
1098175406 12:67785097-67785119 AAGAACTGGCTTGGAAAAACAGG + Intergenic
1098512635 12:71335899-71335921 TTGGACTAACTGGGAAAAACAGG - Intronic
1099882778 12:88488474-88488496 GTAAAGTCACTTGGGAAAACAGG + Intergenic
1101234702 12:102776771-102776793 ATGATCCCACTTGAAAAAACAGG + Intergenic
1101383302 12:104233354-104233376 CAGGACACAATTGGAAAAACTGG - Intronic
1102316519 12:111892364-111892386 ATAAATTCACTTTGAAAAACTGG - Intronic
1104213344 12:126711624-126711646 CTGACCTCATGAGGAAAAACAGG - Intergenic
1104574296 12:129952675-129952697 GTGAACTGACTTGGAAAAAAAGG + Intergenic
1104783598 12:131435843-131435865 CAGAACTCTCTTTGAAAAAATGG + Intergenic
1105466516 13:20646887-20646909 CTGAAATCTCTTGGAATAAATGG - Intronic
1107436694 13:40386694-40386716 CTGAACTCTGTTGAAAAAAATGG - Intergenic
1107971027 13:45642500-45642522 CAGGACACAATTGGAAAAACTGG + Intergenic
1110907315 13:80907942-80907964 CTGAAATAAGTTGGAAAAACTGG - Intergenic
1110952927 13:81518056-81518078 CAGAACACAATTGGAAAAACTGG - Intergenic
1112217838 13:97453234-97453256 GTTACCTCACTGGGAAAAACTGG - Intronic
1113046649 13:106163278-106163300 AAGACCTCACGTGGAAAAACTGG + Intergenic
1113749882 13:112769610-112769632 CTCATCTCACCTGGAAAACCAGG - Intronic
1114051772 14:18925020-18925042 CTGAACTCACATGAAATAAAAGG - Intergenic
1114110787 14:19476905-19476927 CTGAACTCACATGAAATAAAAGG + Intergenic
1115723864 14:36191975-36191997 CTAAACTTAGTTGGAAAAACTGG - Intergenic
1116013426 14:39378000-39378022 CTGGAGCCCCTTGGAAAAACTGG - Intronic
1116329647 14:43579147-43579169 CTGGACTCTTTGGGAAAAACAGG + Intergenic
1116508716 14:45717265-45717287 ATTAACACACTTGGAAAATCTGG + Intergenic
1116678831 14:47939967-47939989 CTGGACTCCATGGGAAAAACAGG + Intergenic
1116800459 14:49438266-49438288 CTAAACTCATTTCGAGAAACAGG + Intergenic
1117307679 14:54492346-54492368 CAGAACACAATTGGAAACACTGG - Intergenic
1119273612 14:73332059-73332081 CTGGACTCAAATGGAAAAAAAGG - Intronic
1124552910 15:30698150-30698172 TTTAACTCACTTGGAAAAGATGG + Intronic
1124678333 15:31707520-31707542 TTTAACTCACTTGGAAAAGATGG - Intronic
1125110873 15:36032289-36032311 CTGAAATCACATGAAAAAAAGGG + Intergenic
1126196416 15:45936758-45936780 CTGATCCCACTTGGAACAATAGG - Intergenic
1127618877 15:60713972-60713994 CTGTTCTCACTTGGCAAAACCGG + Intronic
1128901930 15:71430956-71430978 CAGAACACAATTGGAAACACTGG - Intronic
1130715327 15:86328551-86328573 CTTAACTCAAGAGGAAAAACAGG + Intronic
1131756150 15:95564534-95564556 CTGAGCTAACTTAGAAAGACAGG - Intergenic
1133999928 16:10775050-10775072 TGGCACTCACTCGGAAAAACAGG + Exonic
1134277414 16:12789104-12789126 CTGGATTCTCTTGGAAAATCTGG + Intronic
1135745630 16:25014666-25014688 CTGAACTCACTGAGCAAATCCGG + Intronic
1136352044 16:29716926-29716948 CAGGACACAGTTGGAAAAACTGG + Intergenic
1139247414 16:65459309-65459331 CTGCACCCACTTTGAAAAACCGG - Intergenic
1140103107 16:71935637-71935659 CAGATCTCACTTGGACAAATGGG + Intronic
1140877518 16:79166476-79166498 CTGAACTCTCGTTGAAAAATAGG - Intronic
1141005607 16:80348976-80348998 CAGAGCTCACCTGGAAAACCAGG + Intergenic
1143985674 17:10911706-10911728 CTGTCCTTAATTGGAAAAACAGG - Intergenic
1144109350 17:12017288-12017310 CTGAATTTAATTGGAAATACAGG - Intergenic
1145114555 17:20197185-20197207 CTGAACTCCTTGGGAAAAACAGG - Intronic
1146476692 17:33168341-33168363 CTGAAATAATTTGGAAAAGCAGG + Intronic
1148632690 17:49123916-49123938 CAGGACACAATTGGAAAAACTGG - Intergenic
1149097182 17:52856846-52856868 CTGAACTAACTTTTAAAAACAGG + Intergenic
1150753176 17:67885186-67885208 CTGAACTACCATGGAAAGACAGG + Intronic
1150886728 17:69095280-69095302 CTCACCTTACTCGGAAAAACTGG - Intronic
1151378233 17:73706499-73706521 TTGAAGTCACTCGGAATAACCGG + Intergenic
1151926738 17:77203208-77203230 CTGGGCTCACTTTGAACAACTGG - Intronic
1153218428 18:2841802-2841824 TTGAAATCACATGGAAAAAAAGG - Intergenic
1154133697 18:11758070-11758092 CTGGAATCACTTGGTAAAGCAGG + Intronic
1155617964 18:27743480-27743502 ATGGACTCACCTGGAAAATCGGG - Intergenic
1156998990 18:43501456-43501478 CTGAATTGACTTGCAAATACTGG - Intergenic
1158149987 18:54357534-54357556 CTGAACTCACTTGGAAAAACTGG + Intronic
1161133167 19:2603731-2603753 TTGAACACGCTAGGAAAAACTGG - Intronic
1163250157 19:16122077-16122099 CTGAGCTCACCTGGAAGAACCGG - Intronic
1164776534 19:30857599-30857621 CTGAAGTCACTATGTAAAACTGG + Intergenic
1165568562 19:36755069-36755091 CTGAACACACTTCCAGAAACTGG + Intronic
1166418910 19:42619087-42619109 CAGGACACAATTGGAAAAACTGG + Intronic
1167713526 19:51126204-51126226 CTGGACTCACTTTGGCAAACAGG + Intronic
924972766 2:144294-144316 CAGGACACAATTGGAAAAACTGG - Intergenic
926457579 2:13086837-13086859 TTAAAGTCCCTTGGAAAAACTGG + Intergenic
928131224 2:28651973-28651995 TTGAACTCATTTGCAAAAAATGG - Intergenic
928450461 2:31373863-31373885 CCGTACTCACTTGGAAGAGCTGG + Exonic
928663184 2:33524711-33524733 CTGAGTCCACCTGGAAAAACAGG + Intronic
930119628 2:47749732-47749754 ATAAACACCCTTGGAAAAACTGG + Intronic
931437252 2:62258653-62258675 CAAAACACAATTGGAAAAACTGG - Intergenic
931837643 2:66115940-66115962 CTGAAGTAAATGGGAAAAACTGG - Intergenic
932196846 2:69791353-69791375 CAAAACACAATTGGAAAAACTGG - Intronic
933809042 2:86021081-86021103 CTGAACGCACGTGGAACATCAGG + Exonic
933914852 2:86979755-86979777 CTGACCTCACTTGTTAGAACTGG + Intronic
934008142 2:87790145-87790167 CTGACCTCACTTGTTAGAACTGG - Intronic
935771779 2:106431081-106431103 CTGACCTCACTTGTTAGAACTGG - Intronic
935908294 2:107864860-107864882 CTGACCTCACTTGTTAGAACTGG + Intronic
935941213 2:108241245-108241267 CAGGACACAATTGGAAAAACTGG - Intergenic
935994700 2:108757091-108757113 CTGACCTCACTTGTTAGAACTGG + Intronic
936463524 2:112727930-112727952 CTGAGCTCACTCGGAAGTACAGG - Intronic
937350993 2:121161641-121161663 CAGAATTCACTTTAAAAAACTGG - Intergenic
938284514 2:130098600-130098622 CTAACCTCACTTGTAAAAAATGG + Intronic
938335153 2:130487165-130487187 CTAACCTCACTTGTAAAAAATGG + Intronic
938354672 2:130633503-130633525 CTAACCTCACTTGTAAAAAATGG - Intronic
938431093 2:131240291-131240313 CTAACCTCACTTGTAAAAAATGG - Intronic
939071966 2:137554815-137554837 CAGAAGGCACTTGGAAAATCGGG + Intronic
941339447 2:164288310-164288332 CTGAACTCAATTTACAAAACAGG + Intergenic
941408026 2:165116415-165116437 CTGAGATCACTTGGGAAGACAGG + Intronic
943848307 2:192680565-192680587 CTAAATTCTCTTTGAAAAACAGG + Intergenic
944110455 2:196125908-196125930 CTGGACACAATTGGAAAAACTGG - Intergenic
944276801 2:197848356-197848378 TTCAACTTACTTGGTAAAACGGG + Intronic
944519837 2:200554029-200554051 CAGAACACAATTGGAAAAACTGG - Intronic
944719501 2:202408792-202408814 TTGAACTATCTTGGAAACACAGG + Intronic
945184801 2:207129099-207129121 CTAAACTAACTTCAAAAAACAGG + Intronic
945363795 2:208926283-208926305 ATGTCCTCACTTGGTAAAACAGG - Intergenic
945629350 2:212253621-212253643 CAGAACACACTTGGAAAACAAGG + Intronic
946789645 2:223287133-223287155 CTAAACAAACTTTGAAAAACTGG + Intergenic
947304258 2:228725949-228725971 CTTTACTCACTGGGAAATACGGG + Intergenic
947316336 2:228863405-228863427 CTGAACAGAATTGGAAAGACTGG - Intronic
1168821974 20:780149-780171 CAGGACACAATTGGAAAAACTGG - Intergenic
1170864743 20:20143245-20143267 TTAAACTCACTGGGAAATACAGG + Intronic
1176863135 21:14025145-14025167 CTGAAGTCTCTTGGAAAAACTGG - Intergenic
1177813719 21:25952704-25952726 CTGAAGTCACATGTGAAAACAGG + Intronic
1177959854 21:27649874-27649896 CTGGACAAACTTGGAAAGACAGG + Intergenic
1178178398 21:30131490-30131512 ATAAACTCACTTGGATATACAGG - Intergenic
1178952774 21:36998790-36998812 GTGACCTTACTTGGAAAAAGAGG - Intergenic
1180470245 22:15647395-15647417 CTGAACTCACATGAAATAAAAGG - Intergenic
1181446590 22:22980964-22980986 CAGGACACAATTGGAAAAACTGG + Intergenic
1181782355 22:25202330-25202352 CTGACCTCTCTTGAAAAAATTGG + Intronic
1181837375 22:25621997-25622019 CAGGACACAGTTGGAAAAACTGG - Intronic
1182736307 22:32533963-32533985 GTGGATTCACATGGAAAAACAGG + Intronic
1183149075 22:36023324-36023346 CTGAACCCACTTGGCTAAACTGG + Intronic
1185168690 22:49278341-49278363 CCCAACTCACTTGGACAAACGGG + Intergenic
949380725 3:3442757-3442779 CTGAACTTATTTGAAAAAAATGG - Intergenic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
956629645 3:71303466-71303488 CTGTACTCATTTGCAAAAACTGG + Intronic
956952908 3:74302801-74302823 ATGAACTCTGTTGGGAAAACAGG + Exonic
961334929 3:126169408-126169430 CAGAATACAATTGGAAAAACTGG + Intronic
965481898 3:169229067-169229089 CTGCACTGGCTTGGAAACACTGG + Intronic
965554750 3:170007414-170007436 CTGAAGACACATGGAAAAAATGG + Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
966688094 3:182717504-182717526 CAGGACACAATTGGAAAAACTGG - Intergenic
966809374 3:183829667-183829689 ATGAACTGATTTGGAAGAACAGG - Exonic
967613916 3:191542083-191542105 ATGAACTAACTCCGAAAAACAGG - Intergenic
967649610 3:191970193-191970215 CTAAAATCACTTGTAAAAAGAGG + Intergenic
968393236 4:210395-210417 CTGAAGTCTCTTGGAAAAACTGG - Intergenic
968402345 4:308710-308732 CTGAAGTCTCTTGGAAAAACTGG + Intergenic
970322727 4:14891173-14891195 GTGAGCTCATTTGGAAACACAGG + Intergenic
971075364 4:23141827-23141849 CAGAACTCATTTGGAGAAAAAGG - Intergenic
971355450 4:25890938-25890960 CACCACTCACTTGGAAAAGCTGG + Intronic
971540700 4:27813264-27813286 CAGAACTCAATTGGAAAAACTGG + Intergenic
971886399 4:32455235-32455257 CAGAACACAGTTGGAAAAACTGG + Intergenic
972036349 4:34527040-34527062 CTGAACTCAGTTTTAAATACTGG + Intergenic
972157192 4:36179035-36179057 CTGAACTCACACGAAAAAAATGG + Intronic
972577305 4:40363770-40363792 CTGGACTGTCTTGGACAAACTGG + Intergenic
973014096 4:45114936-45114958 CTGTACCCACATGTAAAAACAGG + Intergenic
973090138 4:46125260-46125282 CTGAAATCACTTAAAGAAACCGG + Intergenic
974111283 4:57528550-57528572 CTCAAGTAACTTGGAACAACAGG - Intergenic
974498893 4:62671682-62671704 TTGAACTCATTTGCAAAAGCTGG - Intergenic
974674969 4:65077726-65077748 CAGAACACAGTTGGAAAAACTGG + Intergenic
975614397 4:76231963-76231985 CGGGACACAATTGGAAAAACTGG - Intronic
975730341 4:77331690-77331712 CAGGACACAATTGGAAAAACTGG - Intronic
976694868 4:87908633-87908655 CTGAAGTCACTTGGATATAAAGG - Intergenic
978328792 4:107588578-107588600 CAGAACACAATTGGAGAAACTGG - Intergenic
978946906 4:114510527-114510549 CTGGACTAACTTGGAGAAAGAGG + Intergenic
979810350 4:125028812-125028834 CTGAGCTCTCTTGGAAATATAGG + Intergenic
979960949 4:127020818-127020840 ATGGACTCACCTGGAAAATCGGG + Intergenic
980022457 4:127725848-127725870 CTGAACATATTTGGAAAAATAGG - Exonic
980208766 4:129757396-129757418 CTGAACTAACTTGGCCAGACAGG - Intergenic
980231551 4:130052071-130052093 CAGACGTCACCTGGAAAAACGGG - Intergenic
980269752 4:130568726-130568748 CAGTACACAATTGGAAAAACTGG - Intergenic
980866516 4:138559722-138559744 CTGTACTTTCTTGGAAATACAGG - Intergenic
981099538 4:140815069-140815091 ATGAGCTCACCTGGAAAAAGTGG - Intergenic
981814528 4:148815408-148815430 CTGAAGATACTTGGAAAAAGTGG - Intergenic
983227530 4:165099029-165099051 CTGGACTCAAATTGAAAAACAGG + Intronic
985661292 5:1158140-1158162 CTGGACTGACATGTAAAAACAGG + Intergenic
986766220 5:10930748-10930770 CTGAGCTAAATTGGAGAAACAGG + Intergenic
988570587 5:32361119-32361141 CAGCAGTCACTTTGAAAAACAGG - Intronic
994537598 5:101050700-101050722 CTAAACTAACTTGCAAACACTGG + Intergenic
995393702 5:111665365-111665387 CAGGACACAGTTGGAAAAACTGG - Intronic
995397365 5:111701571-111701593 CTAAACTCACTTGAAAGAATTGG - Intronic
995558884 5:113359368-113359390 CTGAACTCACTTGGGCACAGTGG - Intronic
995719680 5:115117533-115117555 CAGACCTTACCTGGAAAAACGGG + Intergenic
997701579 5:135904721-135904743 CAGAACTCATTTGTAAAATCTGG + Intergenic
998345444 5:141458006-141458028 CAGAACACAATTGGAAAAACCGG - Intronic
999139949 5:149353682-149353704 CTGAATTTACTTGCCAAAACGGG - Exonic
999335253 5:150710510-150710532 CTGTATTCACTTAGAAAAAGAGG + Intronic
1000069690 5:157728335-157728357 CAGGACACAGTTGGAAAAACTGG - Intergenic
1002341564 5:178519536-178519558 CTGGCTTCTCTTGGAAAAACTGG - Intronic
1002515995 5:179759389-179759411 CTGAATTCACTGGGAATAATAGG + Intronic
1002682492 5:180978214-180978236 CAGAACACAATTGGAGAAACTGG - Intergenic
1003028449 6:2579415-2579437 CTGAACTCACTTGGAAAACGCGG - Intergenic
1005119560 6:22374995-22375017 CAGGACACAATTGGAAAAACTGG + Intergenic
1008017676 6:46540344-46540366 CTTAACTCACAGGGAAAAAGTGG - Intergenic
1008563512 6:52745001-52745023 CTGATCTCACTTGGAGACACAGG - Intergenic
1008564797 6:52756646-52756668 CTGATCTCACTTGGAGACACAGG - Intronic
1008569129 6:52797972-52797994 CTGATCTCACTTGGAGACACAGG - Intronic
1008575948 6:52860310-52860332 CTGATCTCACCTGGAGACACAGG - Intronic
1009766863 6:68088797-68088819 CTGAACTCAAATGAAAACACTGG + Intergenic
1009820619 6:68796494-68796516 CAGAAATCACTTCGAAAGACTGG - Intronic
1010562514 6:77368442-77368464 CTGAATTCAGGGGGAAAAACAGG - Intergenic
1012694025 6:102354907-102354929 CAGGACACACTTGGAGAAACTGG - Intergenic
1013176502 6:107682000-107682022 CTGATCTCATCTGGAAACACTGG + Intergenic
1013365372 6:109433664-109433686 CTGAACTCACTAGGTTCAACTGG - Intronic
1013391386 6:109689588-109689610 CTGAATTCACTAGGGAATACTGG - Intronic
1013784387 6:113763722-113763744 TTGCACTTAGTTGGAAAAACAGG - Intergenic
1015208438 6:130668191-130668213 CTGAACTCCCATGGAGAAATAGG + Intergenic
1015272139 6:131347760-131347782 CTGAATCAACTTGAAAAAACTGG - Intergenic
1015582758 6:134744567-134744589 CTGAACTCATTAAGAAAGACTGG + Intergenic
1016368387 6:143343291-143343313 ATGAACTGATTTGGAAGAACAGG + Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017107790 6:150904414-150904436 CTGAATTCACTAGGAGACACAGG + Intronic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1017887818 6:158613695-158613717 CAGAACACAATTGGAGAAACTGG - Intronic
1018040417 6:159916723-159916745 CTGCACTCACTTGCAAATACAGG - Intergenic
1018699219 6:166413304-166413326 CTGGACTCATTTGGAGGAACAGG + Intronic
1019531480 7:1505739-1505761 CTGAACGCACACGGAAAAGCCGG - Intergenic
1020350364 7:7212387-7212409 CAGGACACAATTGGAAAAACTGG - Intronic
1021311036 7:19096326-19096348 CTGAAATCACTAGCACAAACAGG + Intronic
1022416242 7:30179548-30179570 CTGAGCTCACTTGTCAAAGCAGG + Intergenic
1022609000 7:31849642-31849664 CTGATTTCACTTGAAAAAGCAGG - Intronic
1022929211 7:35093206-35093228 ATGGACTCACCTGGAAAATCGGG + Intergenic
1023588597 7:41757621-41757643 CTGAGCTCCTTGGGAAAAACAGG - Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1029059193 7:97779208-97779230 CAGAACGCACCTGGAAAATCAGG - Intergenic
1029700662 7:102244771-102244793 CTGCTCTCCCCTGGAAAAACAGG + Intronic
1029863221 7:103597853-103597875 CTGAAATCATTTTGAACAACAGG - Intronic
1030908773 7:115220404-115220426 CTCTACACACTTGGAAAAAAGGG + Intergenic
1031305068 7:120115718-120115740 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1031742892 7:125456450-125456472 CTGGACTTATTGGGAAAAACAGG - Intergenic
1033505758 7:141998058-141998080 CTAAATTAATTTGGAAAAACTGG - Intronic
1033760323 7:144430292-144430314 CCGAATGCATTTGGAAAAACAGG - Intergenic
1035300286 7:157892939-157892961 CTGCACTCACTTGGGGCAACAGG + Intronic
1035589108 8:799604-799626 GTGAACTCACTTTTAAAGACAGG + Intergenic
1037955488 8:23054529-23054551 CAGGACACAATTGGAAAAACTGG + Intronic
1039238975 8:35533801-35533823 ATGGACGCACTTGGAAAATCGGG - Intronic
1040718129 8:50283243-50283265 CTGAACTCTCATGGAAAAGCAGG - Intronic
1040758244 8:50807114-50807136 CAGGACTCAATTGGTAAAACTGG + Intergenic
1041410695 8:57551095-57551117 CAGATGTCACATGGAAAAACTGG + Intergenic
1041607379 8:59798802-59798824 TTGAACACAGTTGGAAAAATTGG + Intergenic
1041689001 8:60671234-60671256 TTGAACTCAATTGAAAAAGCTGG - Intergenic
1042277646 8:67022335-67022357 CAGAACTCAGTAGGAAAAATGGG - Intronic
1042623269 8:70729142-70729164 CTGGACACAATTGGAGAAACTGG - Intronic
1042702986 8:71637155-71637177 CTGAAATCACTTGGAGAGATAGG + Intergenic
1044032827 8:87259772-87259794 CTGGACTCCTTAGGAAAAACAGG - Intronic
1044378300 8:91502111-91502133 CAGGACACAATTGGAAAAACTGG - Intergenic
1045200944 8:99980553-99980575 CTAAACTTCCTTGGGAAAACAGG + Intronic
1045399509 8:101798695-101798717 CTGAAATAACTTTGAAAAAAAGG + Intronic
1045538809 8:103061383-103061405 CTGAATTTACTTGGCTAAACAGG + Intronic
1046092531 8:109520218-109520240 CTGTACTCACTTGGACTTACAGG + Intronic
1047581426 8:126219905-126219927 CAGAACACAGTTGGAGAAACTGG - Intergenic
1049500526 8:142960955-142960977 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1050064937 9:1749786-1749808 CAGACGTCACCTGGAAAAACGGG + Intergenic
1050392919 9:5165740-5165762 CTTAACTCACTTAGCAATACTGG + Intronic
1050879964 9:10687313-10687335 CTGAACTCTCTGAGAAAAAATGG - Intergenic
1050923159 9:11231181-11231203 CAGTACACAATTGGAAAAACTGG - Intergenic
1051782170 9:20701303-20701325 ATGAGTTCACTTGTAAAAACAGG - Intronic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1052926887 9:34024601-34024623 CTGAAATCTTCTGGAAAAACGGG + Intronic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1056248056 9:84718250-84718272 CAGAACACACTTGGAAGGACAGG - Intronic
1056745861 9:89301972-89301994 CAGAACACAATTGGAAAACCTGG + Intergenic
1057347849 9:94267407-94267429 CAGGACACAATTGGAAAAACTGG - Intronic
1059184535 9:112255755-112255777 CTGAAATCACTTGGTAAATTTGG - Intronic
1060126384 9:121051681-121051703 CTGAATTCACTAGGGAAAAAAGG + Intergenic
1061204875 9:129157060-129157082 CTGAACCCACTTGGACAAGCTGG - Intergenic
1061221888 9:129256967-129256989 CGGGAATCACTTTGAAAAACAGG + Intergenic
1061798947 9:133103902-133103924 CTGGTCTCACTTGGAACAGCTGG + Intronic
1186305078 X:8247620-8247642 CTAAACACACTGGGATAAACTGG - Intergenic
1187817240 X:23246079-23246101 CAGAACACAGTTGGAGAAACTGG + Intergenic
1189602134 X:42638462-42638484 GTGAACTCTATTGTAAAAACTGG + Intergenic
1189615911 X:42784150-42784172 CAAAACGCTCTTGGAAAAACTGG + Intergenic
1189835557 X:45017775-45017797 AGGAATACACTTGGAAAAACTGG + Intronic
1190149717 X:47935077-47935099 CAGAACGCAATGGGAAAAACTGG + Intronic
1190723018 X:53166728-53166750 CGGGACACAATTGGAAAAACTGG + Intergenic
1191604921 X:63050866-63050888 CTGAAGTCACTGTGAAAAGCAGG + Intergenic
1191765068 X:64689422-64689444 CTCAATTCACTTGGCAAAATGGG + Intergenic
1192777279 X:74258444-74258466 CAGGACACAATTGGAAAAACTGG + Intergenic
1193338291 X:80316498-80316520 CAGAACAAAGTTGGAAAAACTGG + Intergenic
1193365347 X:80624884-80624906 CTGAAAACACTTGTAAACACTGG - Intergenic
1193705352 X:84814317-84814339 CAGGACACAATTGGAAAAACTGG - Intergenic
1193833781 X:86318007-86318029 CAGGACACAATTGGAAAAACTGG - Intronic
1194200311 X:90946872-90946894 CAGAACACAGTTGGAGAAACTGG + Intergenic
1194402877 X:93459853-93459875 CAGAATGCAATTGGAAAAACTGG - Intergenic
1194436119 X:93870077-93870099 CAAAACACAATTGGAAAAACTGG - Intergenic
1195751786 X:108167179-108167201 CTGGACTGAGTTGGAAAAATGGG - Intronic
1196074227 X:111557045-111557067 CAGGACACAATTGGAAAAACTGG - Intergenic
1196251385 X:113464308-113464330 CCGAATGAACTTGGAAAAACGGG + Intergenic
1197343354 X:125301160-125301182 ATGTGCTCACTTGAAAAAACTGG + Intergenic
1198156416 X:133965224-133965246 GTGACCTTATTTGGAAAAACGGG + Intronic
1198249334 X:134864885-134864907 GTAAAATCACTTGGGAAAACAGG - Intergenic
1198989139 X:142490808-142490830 CTGACCACACTTGTAAAAGCTGG + Intergenic
1199230225 X:145428550-145428572 TTGAATTCACTTTGATAAACTGG + Intergenic
1199651635 X:149950776-149950798 CTAACCTTACTTGGCAAAACTGG + Intergenic
1200546308 Y:4523265-4523287 CAGAACACAGTTGGAGAAACTGG + Intergenic
1200877637 Y:8175160-8175182 CAAAACACAATTGGAAAAACTGG - Intergenic
1200912474 Y:8543361-8543383 CTGGACCCACTTTGAAAAAAGGG + Intergenic
1201864589 Y:18636238-18636260 AAGAACACAGTTGGAAAAACTGG + Intergenic
1201868733 Y:18684140-18684162 AAGAACACAGTTGGAAAAACTGG - Intergenic