ID: 1158155902 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 18:54425265-54425287 |
| Sequence | TGTCAAGTACAAATAGAGGA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1158155902_1158155907 | 21 | Left | 1158155902 | 18:54425265-54425287 | CCATCCTCTATTTGTACTTGACA | No data | ||
| Right | 1158155907 | 18:54425309-54425331 | GAAGCATATGGTTTGTCTGTTGG | No data | ||||
| 1158155902_1158155905 | 9 | Left | 1158155902 | 18:54425265-54425287 | CCATCCTCTATTTGTACTTGACA | No data | ||
| Right | 1158155905 | 18:54425297-54425319 | CCCTGTGTTTGAGAAGCATATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1158155902 | Original CRISPR | TGTCAAGTACAAATAGAGGA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||