ID: 1158155902

View in Genome Browser
Species Human (GRCh38)
Location 18:54425265-54425287
Sequence TGTCAAGTACAAATAGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158155902_1158155907 21 Left 1158155902 18:54425265-54425287 CCATCCTCTATTTGTACTTGACA No data
Right 1158155907 18:54425309-54425331 GAAGCATATGGTTTGTCTGTTGG No data
1158155902_1158155905 9 Left 1158155902 18:54425265-54425287 CCATCCTCTATTTGTACTTGACA No data
Right 1158155905 18:54425297-54425319 CCCTGTGTTTGAGAAGCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158155902 Original CRISPR TGTCAAGTACAAATAGAGGA TGG (reversed) Intergenic
No off target data available for this crispr