ID: 1158156420

View in Genome Browser
Species Human (GRCh38)
Location 18:54430619-54430641
Sequence TGAAGGCTGCTCCACGGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158156417_1158156420 4 Left 1158156417 18:54430592-54430614 CCAAAGCATGAAGAGGAAGCATG No data
Right 1158156420 18:54430619-54430641 TGAAGGCTGCTCCACGGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158156420 Original CRISPR TGAAGGCTGCTCCACGGTGA AGG Intergenic