ID: 1158160154

View in Genome Browser
Species Human (GRCh38)
Location 18:54472602-54472624
Sequence GCTTCTATTTCCACTGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158160152_1158160154 -2 Left 1158160152 18:54472581-54472603 CCAGTTTATCAACTCCTCTAAGC No data
Right 1158160154 18:54472602-54472624 GCTTCTATTTCCACTGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158160154 Original CRISPR GCTTCTATTTCCACTGAAGC AGG Intergenic
No off target data available for this crispr