ID: 1158161408

View in Genome Browser
Species Human (GRCh38)
Location 18:54488648-54488670
Sequence TTGAATATACAGATGGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158161408_1158161412 9 Left 1158161408 18:54488648-54488670 CCATTGTCCATCTGTATATTCAA No data
Right 1158161412 18:54488680-54488702 TTAGTGATTTACGGCCTCATGGG No data
1158161408_1158161410 0 Left 1158161408 18:54488648-54488670 CCATTGTCCATCTGTATATTCAA No data
Right 1158161410 18:54488671-54488693 TTTCTCTGTTTAGTGATTTACGG No data
1158161408_1158161411 8 Left 1158161408 18:54488648-54488670 CCATTGTCCATCTGTATATTCAA No data
Right 1158161411 18:54488679-54488701 TTTAGTGATTTACGGCCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158161408 Original CRISPR TTGAATATACAGATGGACAA TGG (reversed) Intergenic
No off target data available for this crispr